MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: Acox3    
Morpholino sequence: catgttcttaacctaaggcacttgt
Find in Genbank
Target name: acox3
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GACAAGTGCCTTAGGTTAAGAACATGAGTGATCCAGCCATCACAGATGCTAAATATGTATTGGGAGACA AAATGGATGAAGGCATCCCAGATTTTCCCAATGGTCCTCTGGACATCTACAGGAAGAAAGCATCCTTCAG CTGGAAGGACATGATGCGCTTTCTGGAGGGGGATGAACTCATTGCATTCAAGCAGCACGTGTTCAGGACT CTGGAGAGCGACCCGCTTTTTGCCCGGCAGCCTGGTGAGGACGTCCCAGTGGAGCAGAAGCGAGAGCTCA CCTTCCTCCGCTGTAAACAGTTGTTTAAGTATGACTTTATAACACGAGAAGAGCTAATGCAGAACCCCTG GAAGATGACCGTCCTCAACGACTGCCTGGGAATGTATGACTGGTCTTTATGTGCCAAGTACTTCCTTAAC AAAGGGATGTTTGGAGCCACTGTGGTAAACACAGGATCTCAGAGGCACTTGAAGTTTGTGAAGGACATCG AGCGAATGATGACATTTGGATGCTTTTCATTGACAGAGCTGAGCCATGGCAGTAACACAAGAGCCCTGAG GACAACAGCCAAATATGACCCCAACACTCAGGAGTTTGTGATCAACTCACCAGACTTTGAAGCAGCAAAG TTCTGGGTGGGGAACTTGGGAAAGACCGCCACTCATTCAGTTGTATTTGCCCAGCTCTACACACCTGATG GAAAATGTCACGGCCTCCACTCTTTCATAGTACAAGTCAGGGATCCAAAGACCTTGTTGGCTATGCCAGG AGTGATGGTTGGGGATATGGGAAAGAAACTGGGTCAGAACGGTCTGGATAATGGTTTTGCAGTGTTTCAC AATGTGAGGATACCTCGGGAAAACTTGCTAAACAAAACTGGAGATGTTGCTCCTGATGGGCAATATGTTT CACCTTTTAAAGACCCCAATAAGCGGTTTGGGGCTTCTTTAGGTGCTCTGTCAGGAGGTAGGGTGGGCAT TACGAGGATGGCACTGGTCAATCTGAAGCTGGCAGTGACTGTGGCTGTGCGATTCTCTGCCACACGCAGA CAGTTTGGGCCCAAAGAGGACGAGGAGATTCCAGTGCTGGAATATCAACTGCAGCAATGGCGTCTTATTC CATTCCTGGCAGCCGTGTATGCACTGGAGCACTTCACCAAATCTTTCAGCATGAACTTTGTGGAATTTCA AATGGGACTTTTAATGAAGGACAAGAGCGACAGACAGGCTGAACTGGGCAGAGAGATCCATGCCTTGTCC TGTGCGAGTAAACCTTTGGGATCATGGACTGCTCAGCGAGGTATTCAGGAATGTCGAGAGGCCTGTGGAG GACACGGTTACCTTGCCATGAACCGACTGGGGGACATGCGGGACGACAACGACCCAAACTGCACATATGA GGGAGACAACAACGTCCTCCTGCAGCAGACCAGCAACTACCTGCTCAGCTGGATCCAACACAAACAAGAA GGTAAAGGAAGGATCGAATCCCCTCTCGAGACTGTCAACTTCTTAGACGACATGAGCAGCATTCTGCAGA GCAAGTTCACAGTTGGCTCAGTGGAAGAGTGCATGAACTCAGCCGTGCCCCTGGCAGCGTATAAGTGGCT GGTGTGTTTCTTGCTGGGTGAGAGCCAGAAGAAGCTGTTTGAGGAAAAATCTTCTGGACTGGGAGACTTT GAGGCACGAAACAACAGCCAAGTGTATTACTGTCGTTCATTGGCTATCGCCTTTATTGAGCACACAGTAC TGCAGCGTTTCCATGATCTGATTCAGGATGAACAGACTCCAGCTGTTCTCAGATCAGTGCTGGGGCGTCT CTGTGCTCTCTATGGCTTGTGGACTCTCACCAATCACATGGCAATCTTGTATCAAGGAGGTTATTTTTCT GGTGGGCAGCCGGTTGACTTCATCCAGACAGCCATTCTCACTCTGTGTGGGCAGCTGAAGGATGACGCTG TGGCATTGGTTGATGTTTTCGCTCCTCCTGACTTCATCCTCAACTCTCCCATTGGCAAATCGGATGGTGA GCTCTACAAAAACCTGTGGTCTACAGTCATGCAGGGTAAGAACGTTCTGGAACGGCCATCTTGGTGGGCT GAATTTTGTTCTGACAAACCTGTTGTTGGATCTCTCCGAGCCAAACTCTAAATCCTCAGTCTGGAAAAAT CATGGCAGACATCCTTCTGTATACCCTTCAAGCCAAGCAGTTTTATCCTGATATTGCAAAACTGTCGTAC AGTTGTCACAATTAAATGAACTGAATGTTGCATCTAAGAAGATGTTAATTTTGCTGTAATATCATGAACC GATTCAGTAAAGCTTCTTAAGATCAGAAAAAAACAGCACGTGGTGTGCTGTAAACATTAATAAAAGTATT TTTGCAGCGCTTCCTTATTCACTATGCCACGATAAACTTTTAATAATAACTCCATATATATTTTGCTGTC TTGATTGAACCTAAATTGCCAGATATGTTGCTTTAAAGGTGACATTGGCTGGCTAATTACAAATGTTGAT ATGATTCTGAAGGGTTAAGCTTTTTAATGGTACTGTAAAAAAAAAAAATTTTACCCTGTCAAAAACACCT CAATTCACATTAAGCCAGTTTGCTTCTTATCTGTTTAACCACTCTCTGAGGCTGCTGGATCGTGATTGGC TAATAGCCTACCAATCAATTCTTGTGGGGTAGTTACTGAATATACCAGCGCACTACACATACAGCTCTCA ATCAAGCCTTTAGCTTCTGCTGAATTTTAGCTGTGAATGACATGAAGTAGAATTTGAAGCTTTCTTAACA TTTCAATGACACAATACATAAAATCGATGCATATAAATGATCATTTCTTGACAATGCAGCATGCCATTAA TCAAACTAACATTTACACAAAGTGGCACTGCTGGATTTGGCAAAAGCTCTATTTCTGAACTGGTAATTTA AAACACACTTACAAGCACAGCTCTGAACACATGACAGAAAGATGATCTAATTTTAAACACAAGTGAATTG AAGTTAACTTTCGATAACAACCTAACAAAAACTACAATTGTATCTAAAGAATGAAGCTTTCAGACAAATT GTAGGTATGCTTGGATTCTTTAAAGAAATAGAAGTCCAGCTTCGTATTTCCGATAACACAGACATTATCA TCTCCCCCTTAAAAATCTTTGACATAAATAGGCTAAGATAGTTAAAAAAAAGCAACTAAACTTCAATAAA TTTATAAAAGGGAACATTTCATCTGATGTCACCTTTAATGCACAGGTAGCTAAACATAGACAACAACCAT ACTCTAACAAAACCTTTACAATAACAATGTTTAGATACTTATTGTACATTTTGTGTCATGTTGATACAGT GCTCAGCTCGTTTTGAAAATTAATATGTTTCTCCATTTCTCAGTGAATATTGATTGAATATTGAATACTT GATTTCTCCTCTTATTTAATTTGTATTTAATAATTTTCTATAACACACATTTGGCTGTACTTGTTTTTGA AACATTATCGTAAGTTATTTGGTTAAATAAGCTCCAGATTTGGCTTCAGTACTGACTAATCTAATGTATA TGCACAAATATAATATTGTAAAGCTTCCTATAGAAAATTTGAATTAAAAAATAGATTTGTGAGTGGTGAA TATGTGTGAGGCGTGAATATGTGTGATTTCATTTTTTCTGAATGGTAAATGATTTTATGCACATTGTCAT CTTGTATTAATATGTAATGTATAATTGCAACAGATTTTGACTTTAAATAATAATAAATATTTCTTAATTA TTTAAAAAAAAAAAAAAA
Gene targeted:
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
None

Images