MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: JR0004    
Morpholino sequence: CAGGGTCTGATACATGTCGGTAGGG
Find in Genbank
Target name: gata6
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
ACCCCAGGGAGACGCATAAGGGAGGCCTCATTGTGGACCCTACCGACATGTATCAGACCCTGGCCATCGCGGCGGCCCAGAGCCAGGCCGGTTATAACGACACGCCGTCGGCCGGTTACATGCACTCCAACCCCACTTCTCCCGTTTATGTGCCTACGTCTCGCGTTGGAACGATGATACCGAATTTGTCTTACCTGCACCGGCGTTATCAACACAGCCGAGCACGCGTGAGCAGTCACTCGGTGTGGTCTCAGCCCGCGCCCGAGAGCCCGTCCTACAGCACTGGAAGCCCGCATACCTCCAACCGGTTCCACTACTCCCCCAGTCCGCCGATGAATAACGGCACATCGAGGGATACCAGCTACACTACTCCTCTGAATGTAAACAGTCGCGACCAGTACCTTTCAAGACCGATAAGTGGATCTTACCCGAGCCCGTACCCTCCGTATGTCACACCGCAGCTCTCACAGCTACCGGCGGCGTGGCCCCGGGGACCCTTCGAGAACTCCATGCTGCACTCACTGCAATCCCGAAGGGCACCGTGGCCATCAGGGGCCCAAGGACATCTGCTGGAGGAGATGGTGGAGAGCCGGGAGTGCGTAAACTGCGGCTCCATGTCCACTCCGCTGTGGAGACGCGACGGCACGGGACACTTTCTCTGCAACGCCTGCGGGCTGTACAGCAAAATGAATGGACTCAGCCGACCATTAATTAAACCTCAGAAGCGCATGTCTTCCTCCCGGCGGATCGGACTGTCATGCGCAAACTGTCAGACGAGCACCACAACACTGTGGCGCAGAAACGCGGAGGGAGAGCCCGTGTGCAACGCCTGTGGTCTTTACACCAAGTTACACGGGGTGCCTCGGCCCCTTGCCATGAAGAAAGAAGGCATTCAGACAAGGAAAAGAAAACCAAAGTCTTTGAGCAAAGTGAAAGGATCATCTGGCAGCAGCTCTGTCCCCATGACTCCAACTTCTTCATCATCTTCTAACTCAGAGGAGTGCACAAAAAACAGTCCTTCGTCAACACAGGTCAACTC
Gene targeted:
GATA-binding protein 6
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
GATA-5
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Morphology: (4)
Pigment: (3)
Vasculature: (5)
Eye: (3)
Kidney: (1)
- pigment cells colorless
(71.43%, dose:3ng, p53:4.5ng, days: -)
- eye small size
(20%, dose:3ng, p53:0ng, days: -)
- eye small size
(50%, dose:3ng, p53:4.5ng, days: -)
- head small size
(20%, dose:3ng, p53:0ng, days: -)
- head small size
(50%, dose:3ng, p53:4.5ng, days: -)
- trunk coiled
(50%, dose:3ng, p53:4.5ng, days: -)
- tail coiled
(20%, dose:3ng, p53:0ng, days: -)
- tail coiled
(50%, dose:3ng, p53:4.5ng, days: -)
- tail short length
(20%, dose:3ng, p53:0ng, days: -)
- pigment cells colorless
(71.43%, dose:6ng, p53:9ng, days: -)
- eye dysplastic
(10%, dose:6ng, p53:0ng, days: -)
- eye medial
(10%, dose:6ng, p53:0ng, days: -)
- eye small size
(10%, dose:6ng, p53:0ng, days: -)
- head dysplastic
(10%, dose:6ng, p53:0ng, days: -)
- tail coiled
(10%, dose:6ng, p53:0ng, days: -)
- pigment cells colorless
(42.86%, dose:9ng, p53:13.5ng, days: -)

Images