MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: Ror2-ATG1    
Morpholino sequence: ATGGGAGAGTACGGCTCCAGGATTG
Find in Genbank
Target name: Ror2
Target sequence: (Morpholino Target and ATG)
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (3)
none: (2)
Vasculature: (5)
Eye: (6)
Pigment: (6)
- dorsal aorta [proposed pooling]
(14.29%, dose:2ng, p53:3ng, days: -)
- eye dysplastic
(28.57%, dose:2ng, p53:3ng, days: -)
- eye small size
(28.57%, dose:2ng, p53:3ng, days: -)
- atrium large size
(14.29%, dose:2ng, p53:3ng, days: -)
- head [proposed pooling]
(14.29%, dose:2ng, p53:3ng, days: -)
- tail coiled
(21.43%, dose:2ng, p53:3ng, days: -)
- tail coiled
(14.29%, dose:3ng, p53:4.5ng, days: -)
- eye small size
(10%, dose:6ng, p53:9ng, days: -)

Images