MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3042    
Morpholino sequence: AAAATATTCTGCTCTCTCTTGGAGA
Find in Genbank
Target name: zgc:111821
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TCAAATCCCGATCCCATCTGATAAACGGGAGCTCAGTCAATCCTCAAAGATCTCCACATTTCTCCAAGAGAGAGCAGAATATTTTGCACACAAAATGAAATCTATTATTGTTTTAACACTCCTCGTCGCCACAGTCTTCTGTGTACCTGTGAAGCGCTCAGCAAGCAGTTCAGAGAGCTCAGAAGAGCTTGTAATTGTTCAACGGCCACCTCCTATTCTTCGAAAAGCTGCTGCCAATGTGTTCCAGGTTGAACCTACACAGACCACGCCAACAGAATCGAATGAAAGCACAGACAGCGCAGATGACACTGAGGAGGCAGATGAGGAATCTGAAACAGATGAGAAGGAAGAGGAGAATGAGACTGACTCCAGTGAGAGTGAATCTGGAGAATCTGATACCACCATCATCCCAGTCACAGTCGATCCCACGCTGGGTCCCATTATCAACACAGGCCGGGGAGACAGTTTGGGCTACCCTAGCGACTACAAAAAATCCATCGTCTATGTGGACGCAAAAGACTTTGAGAAACTTCCTTCACCATACAAATCCTACAGCAGTGACAAACTGGGCGGCTTGACATTTGTGAGCAAGAAGACGTCTGCCTATGATGATCAGAGCATCAATGACGTGGAGAAAGAGATTACACTGTACAAGGCTCTCCAGGTACATGATCTGGAGGACGGGAACACCAGCACCTCAGAGATAGACAACATCGAGGCAAATGAGCGCCAGGCTGCCCTGGGAGCCCAAGAGATTGTTCCCGTTGGGGACCAGGCAGCTACAGAAGAGGGGGCAAGTGCTAGGGACTCTCCCAGCGACAGCGCCAGTGCAAGTGCCAGCCAGGAGGAGAATGAAGAAGAGTCGGATAGTGAGGAGACCACAGCGACGCCGGGAGCTGCAGACAGCGAGTCCAACTCCTCTCAGAGCACAGAAAGCACAGAAAGCCAGGAGAGCGACTCAGATGAGGAGACCACTCAGACCACTGAGGCCTCCATCATCATCGTAAAGTAAACACAGCCGAGCACAAATCCTCCAAGGGCTGTCGACACAAACGAATGCAAATGTATACTGGTGCTTGGTGATTTACTCATGCTTAGCGTGAGTTAGACGACAGACGGCAGTGCACAAAGATGCAGCTCATACACTGAAAAGAAGATTCATTGGATTTACTCAATTTGTTTAAGATAAGTGGTTGCAAACAATTTATTTGGCCTAATTTTTAAACCAATTAAATTTTGTAATGTTCAGCTAATTTCATTTGTTTAAATTCGGCCCATATAAATCATTTGTAACCACTTACCTTTAAAAATGTAGTAAATTCAGTGAATTATTTTTTTTCAGTGTACGAGCTCTCGAACTGCTGCCAAACTTGTTCAGATGCAGTTTCATCTCAACAATGTCTTCCTGTTCATTGCACATTTATTTACAATCTTAATGTAAATGTAATTTTATACTGCTCTATGTAATGATTTATCATTTATGAATAAATTTTGTCCAATAT
Gene targeted:
zgc:111821
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Morphology: (3)
Kidney: (1)
Pigment: (3)
Vasculature: (3)
Eye: (2)
none: (2)
- cardiovascular system [propose absent flow]
(57.14%, dose:3ng, p53:4.5ng, days: -)
- eye small size
(35%, dose:3ng, p53:4.5ng, days: -)
- common cardinal vein edematous
(35.71%, dose:3ng, p53:4.5ng, days: -)
- tail coiled
(40.74%, dose:3ng, p53:4.5ng, days: -)
- tail short length
(57.14%, dose:3ng, p53:4.5ng, days: -)
- cardiovascular system [propose absent flow]
(57.14%, dose:4.5ng, p53:6.75ng, days: -)
- eye dysplastic
(40%, dose:4.5ng, p53:6.75ng, days: -)
- eye medial
(40%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein edematous
(57.14%, dose:4.5ng, p53:6.75ng, days: -)
- trunk coiled
(60%, dose:4.5ng, p53:6.75ng, days: -)
- tail coiled
(37.5%, dose:4.5ng, p53:6.75ng, days: -)
- tail short length
(57.14%, dose:4.5ng, p53:6.75ng, days: -)
- cardiovascular system [propose absent flow]
(100%, dose:6ng, p53:9ng, days: -)
- common cardinal vein edematous
(100%, dose:6ng, p53:9ng, days: -)
- trunk coiled
(70%, dose:6ng, p53:9ng, days: -)
- tail coiled
(100%, dose:6ng, p53:9ng, days: -)
- tail short length
(100%, dose:6ng, p53:9ng, days: -)

Images