MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: limba    
Morpholino sequence: GGCGCAGTGTTGGATGGTTAGCCAT
Find in Genbank
Target name: dominant limb phenotype-like a
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TGAAAGAGCAAGCGTTCTCTTCTCAGCAGGCTTTTGTGCGCAGCTTCTCTCCGCAGCTCAAGGCCAAGTGTTGCATTTGCATGGCAGGCAAAACAAAGGCCACGACAACAGCACTGAGACACGCATCTCATCGGGGCCATCCAACACTGCGCCGAGATGCGCGTAAAGAGGAGCGCTCCGGTGAACACCTGCTACTCCGGGCGACTCCTGAGCAGAGGTGTCTCTTTCCACCCTTTCCCTCTTCCCGTGCCCTGAATCCCAAAGCGTCCCGCAGCACCTCACCGGACTTTCTCTCTCTCATCAGATCCGAGAGCAGGATCTCCCGTCTGGCTCAGAGACTCAACCAGAGGCAGAGCGATGCGGCATTGATTAAGGATTTCAGACCTCTTTTCCTCCTCTCTGGATCTGCTGGAAGCTCCCAGAGTCTGGACAGGAACTTCTCCATCAGTATGAGCCAGCAGATGCAGAACCTGCAGCTGACGCAGAGCAAGAAGGGGGCTGGTCCCGCCTCCCCCAGCGCTGCCAAACGCCTCTACCGGAACCTCTCCGAGAAGTTTAAAGGGAGCCACTCATCCTTCGAGGATGCCTACTTTTTCGGCCGATCCGACCGTATACGCAAAGTATCAAACATCCAGAGCAGCGAGGCTCTGTTCGAGGCTGTTGAACAGCAGGATCTGGATGCCGTTCAGATCCTGCTGTTTCAGTACACAGCTGATGAACTGGACCTGAACACCCCCAATAGTGAAGGCCTGACGCCTCTGGACATCTCCATCATGACCAATAACGTTCCCATCGCCAAACTGTTGCTTAAAGCTGGAGGGAAGGAGAGCCCTCACTTTGTCAGTTTGGAGAGCAGAGACGCTCACCTCTCAGCACTAGTCCAGGAAGCCCAAAGGAGAGCCAGTGAACTGTCCAACCAGGTGATGAGAGAAAGTCTCAGCCTGGAAACGTCTGACAAAGAAAAACAGCTCAAAGCTTGGGAGTGGCGATGCAAACTCTACAAGCGGATGCGCACAGGATTCGAGCATGCACGGCCGCCGGAGGCTCCATTGATGGTGCGTCTGAGTGTGACCGGCAGCACGACTCTCACTGTTAGCATTCAGGAACCTGCCAGCATGAATTCAGCTGTGGTGACCAAATACAAAGTTGAATGGAGCTGTCTGAAGGACTTCTCTTTGTTAGCCGGAGAACTGATCCTTGAGAATCTGCAGTCCCTCAAATGCACAATTACAGGCCTCACCATGGGTAGGCAGTACTATGTTCAAGTCTCTGCTTACAATATGAAGGGTTGGGGTCCAGCACAACTTTCTCAGCCTCCTTCAGCTGTTCCCTCCAACTGGAAGGACTGTGATGGGAGAGAAAGCAGGAGGAGAGGTCACATCGAGGCCATGGAGAGGCTCTTACAGCAGGTTCGAGCCACACACCAGCACTACTGCTGTGGAGACACATCAAAGTTGCAGAATCCAAGTCGTAAACAGTCTGTGTCCCGGAGCCTGAAGCACCTTTTTCACTCCTCTACGAAATTTGTCAAGAGTCTTAAAAGGGGAGTTTATATAGCGTCAGTATTTTACCATAAGGACAGTCTGCTAGTGACTAATGAGGATCAGATCCCCATAGTGGAGGTGGACGATTCATACAGCAGCTCCCTCATGCAGGACTTTCTGTGGTTCACCAAGCTTTCTTGTATGTGGGAGGACGTCCGGTGGCTCAGACAAAGCCTGGCAGTCTCCACCTCATCCTCTTCCACTCTGCAGTCCAGACAGAAGATGCTGGCGGCCGCGGGACAACTGCAGAATCTTCTGGGCACTCACAACCTGGGTCGAGTCCATTATGAGCCCATTAAAGATCGTCATGGAAATGTGCTGCTTGTGACGGTGAGGGAAATGGACAGTCTTTACTCCTTCTTCAACGGGAAGTGGATGCAAGTCTCCAAACTGCAGAGTCAGAGGAAGTCCCTGTCTACACCTGAGGAACCATATGCCCTCGACATCCTACTCATCACCATACAGGACATTCTGGCGTATCAGAGACGGAGTCAGCACCGGCTGTCCTCTGGCCTTTATCTGGGTTACCTGAAACTCAGCAGCTCTGTGGATCAGATCAAGGTTCTGGTTCCTCAGCGGATGCCCAACATGCTTTGCCACACCAAGATACGAGACAACTGGAACGTGTCAAGCTACTCTGGCGCTTCTGGAAAGAGTGATATAGCACTGTGTATGTTAACTAAACGCTGTCTCTTCTCGCCCAGGGATGAGTGGGAATGGCTGCAGTCACTGTCTGGCCCTGTGGAGGTGGAAAGAGCAGATCAGGCTACAGACTGCCTCCTTTTCTCTGAGCTCCAGACAGCCATTAAAAGTCTGCTGCACCAGATTAATCTACCTCTCCACCAGGCCAAGCACTTCCGTCTCTACACACACGAGGTGCTGGAGCTGGGTCACAATGTGTCCTTTCTTCTGCTGCTGCCCGCCTCAGACGACGTCTGCTCTGCCCCGGGACAGACCAACCCCTACACACCACACTCGGGGTTCCTCAACCTCCCTCTTCAAATGTTTGAGCTCGTTCATTTCTGCTCGTATAAGGAGAAATTCATCAGTCTTTACTGCCGGCTGTCCTCAGTGCTGGATCTGGATGCTCTGATTACCCAGCAGGCTTTTAGAGAGGCCATCACTGACTCAGAGGTGTCCACTGCCAAACAGAGGCACCAGCACATTCTGGACTACATTCAGCAATTGGACGAGATGTGGCGAGACGTCCGCTGGATCACCAATGCGCTGCAGTACGCCCGCTATAAACAGCCTCTCGGTTGGGTGCCGATCACCTGGCTAGTAGATGTCAGCGTGGAGCCTCCTGTCCAGAAGAATGACTCCACGTCGTCTAACACGGACTACGTGCCCACTCCCTCACCCTCTCCAGAAATGAGAAGAAGAAAGCCCACTATTGAGTCCCAGCCAGGCTCAGATGAAGAAGGCTGCTCAGAAGTTTTCCTTCCCACTGACAGTGACTATGACTCCAGTGATGCCCTGAGCCCTCGAGACCTAGACTTAGTTTATTCCTCAGCCCAGGATCTCTCCCATCAGGCCGTGCATGTCCTCAGTGGCAGCGCTCCCGATGTCCTCCAAATGCACGATCTTAAATACAGCGTCTGCTCCAAGTCGATCCTGGAGACTGAATCCTGCACAAAAGATTTGGAGGATCTATCGCTCTCCTCTTACTCCGTGAAGACCACCGACAAACCGTCCCGCTCCAAGTTTCTTGCCGATGCCCCAACAAAACGCAAGCTGCTGTCCAAAAGCCATCCTCAGAGGAGTTATTTCGGCGGACCACACCGCTGGCTTCGTGTACAAAGCGAAAGCCACACTCCGTCGCTTTCCGAAGGTATTTACACTAGACAGAGTGATATCGACCTCCCGCTGGAGACACCACTTTCAATACCGCACTCGCCCACTACCTCCTACAGTCTGGATGAGTACAGGCAGCCCTACAGAGAATCCAAACCCAACGTTCGCAGAATATTTGTAGAGTCATGCAGCAAGACTTCACCCTGTAGAGATGCACCGCATTGGGAGGAAGAGGAGGAGAAAGGCTCACGAGGAGCAACGGCGTCGGGGGCTCGTCCGGGATACAGCTCAACATCGGAAGCTCAGGATGTGGATTCAGATGAGCAAACTAATGAACAAGTGTCGGAGATCCTCAGCAGCACTCTTTAG
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (3)
Toxicity: (8)
Pigment: (5)
Eye: (2)
Vasculature: (3)
- cardiovascular system [propose absent flow]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- heart straight angle
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- common cardinal vein edematous
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- cardiovascular system [propose absent flow]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- pigment cells [propose more pigmetation]
(50%, dose:4.5ng, p53:6.75ng, days: -)
- eye dysplastic
(12.5%, dose:4.5ng, p53:6.75ng, days: -)
- heart straight angle
(21.43%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein edematous
(21.43%, dose:4.5ng, p53:6.75ng, days: -)
- tail coiled
(21.74%, dose:4.5ng, p53:6.75ng, days: -)
- heart edematous
(28.57%, dose:6ng, p53:9ng, days: -)
- heart straight angle
(28.57%, dose:6ng, p53:9ng, days: -)
- common cardinal vein edematous
(14.29%, dose:6ng, p53:9ng, days: -)
- tail coiled
(19.05%, dose:6ng, p53:9ng, days: -)

Images