MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3037    
Morpholino sequence: TCCATGCTGAGGAGTTATTAAAATC
Find in Genbank
Target name: bsg
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
AAAGCCCTTCTTTACGTGCGCGTTCTCGAGTGAGCTCCGAGTCCGAACAAATAGAGGACGACTAGGTTCCTCAGAAGGCTTTCTCCATTTTCTTTTTTCATCTCGAACAGGCCCAAAATTTTCCTTTTAGATTTTAATAACTCCTCAGCATGGAAAAGAAGCTCTTTGGCGCTGTTTTGGTCATTTGTATCGGCTGGTTTCAAGCCGAAGCTATGACAGCGGGCTTCATAAAATCGCCTTTGTCTCAGATGAAACTCATTGAAGACAATGCAGAGCTGGATTGCGAGGTCATAGGGAATCCCATCCCTGAAGTTCAGTGGTGGTTTATTGAGGGCGAGGAGCCAGATGAAATCATCACTCAGCTGTTTGATGGTGCAAGAGAGGATCGCGTTCACATCAACGCCACCTATATTGACCACGCCACCAGCTCGCTCATCCTCACCAACCTAACGTTCAACGACACAGGCGTTTATGAGTGCCGTGCCTCAAACGACCCCGACCGCAACGACCTCAGGACCCCGCCCAAAGTCAAGTGGATTCGCTCACAAGCGAACGTTATAGTGTTTGAACGTGCAACCATCATGACTAGTCCCGAGGTGAACAATGCGACCTCGGCAACTCTGAGCTGCAACCTGACCAACCCTTCTTCTCCAATCAAAGGCCACTATTGGGTCAAGAATGGAAAGAAAATCGAAGAATCGGATTCGACAAATACAGACTCCTATGCTGAACACTTCATTGAAAAAGCTGATTATCATCAGTCCGGAATATATACCTGTGTCTTCCTAACAGAACCTCAGGCCAATGCCACCATTGAAGTTAAAGCTTTGCCACATATAAAAGCTTCCAAAAGCTCAGAGAACGCTAATGAGAAAGACAAGGCTGTGCTGAGCTGTGGAAGTCAAGGATACCCATCCCCTATTGACTGGAGCTGGTTCAAGCTTTCTGATGCAGGAGAACGGACCCCCATTTTTAATGGCACCGATAAGTATGAGATCAAGAGCACCCCCAACAAGACCACACTGTATGTCAAAGACCTGGACATCAACGAGGACATGGGCTTCTACCAGTGTCAAGGCACCAGTGAGGTTGGCACTGGTAAAGACGGCATCCAGCTGCGTGTGCGGAGTCAGCTGGCCGCTCTCTGGCCTTTCCTCGGGATCGTGGCTGAGGTCATCATCCTCATCACCATCATCTTCGTCTACGAGAAGAGAAGAAAGCCTGATGAGATCAATGACGATGATGACTCAGGATCTGCTCCCCTGAAGAGCAACTCTGCTACAAACCACAAAGACAAAAATGTCCGGCAAAGAAACTCCAACTGAGGAAGGAGAGAGGGTGTTTTCATGACTGCTGTTGAAGATATAAAGATCGTTGAGTTTGAGTAGCACAATATAGTGCGCCCTGCAACTTCACCCTCTGCTTGAGTGTAAATGTCTTGATGATGATAATAACTGGTCTCCTTTTACTTTTATTCCTCTCCATACTGTGCTGCAAGCAGA
Gene targeted:
basigin
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
5A11/Basigin-2
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (4)
Vasculature: (4)
Eye: (2)
- dorsal aorta [proposed pooling]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- notochord undulate
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- common cardinal vein [proposed pooling]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- tail coiled
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- dorsal aorta [proposed pooling]
(14.29%, dose:2ng, p53:3ng, days: -)
- heart edematous
(42.86%, dose:2ng, p53:3ng, days: -)
- common cardinal vein edematous
(42.86%, dose:2ng, p53:3ng, days: -)
- tail coiled
(20%, dose:2ng, p53:3ng, days: -)
- notochord undulate
(71.43%, dose:3ng, p53:4.5ng, days: -)

Images