MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3033    
Morpholino sequence: CAGCAAATGATACCTGATTAATGTC
Find in Genbank
Target name: cldn12
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CACTGGAGTGTGTTGTGCGCGCTCCCGAAGAAGAAGAGTGTTCATACAACACGGTGGAACCCAACGACAAAAAAACCACCGATTTAAGTGAGAAAATGACTGCTACATCACCTAAACATTCATTAAACGCTCGACATTAATCAGGTATCATTTGCTGACTTCAGCCATGTCTTGTCGTGACATTCACGCCACTAATGCGTTCGCCTTTGTCATTGCGATGCTGTCGGTCGGTGGTTTGACCGTTGCTACACTCATTCCTCAGTGGAGAACCATGCGCCTGCTTACCTTCAACCGTAATGCCAAAAATGTGACTGTATACGATGGCCTGTGGACCAAGTGTGTACGGCGGGATGGCTCTTCAGGCTGCTATTACTTTGACTCAGACTGGTACGCAAAAGTAGACCAGTTGGACCTCAGATTGCTGCAATTCTGTTTACCTACTGGTCTGCTGTTTTCCAGCTTGGCTCTTCTGCTCTGTCTTACTGGCATGTGTAAAACTGCTTGCTGCTCCAAAACCCCTGACGACATCAAGAACTCTCGCTGCTTGGTCAACAGCTCAGGCTGCCATCTAGTAGCTGGGATGCTTCTGTTTCTAGGTGGAGCGATCGCCATGCCACCCTCCGTCTGGTTCCTCTTCCACACCCGTCACCTAAATGAGCGCTACGATCATTTATTTGCTGTTGAGTTTGGGGTGTATGTGGCCATCGGCAGTGCTGGTGGTTTAATCCTGGCTGCTCTGCTGATGTTCATGTGGTATTGTATGTGTAAAAAACTGCCTTCGCCTTTCTGGCTGCCTCTTCCTGAAGTGCCCACAATGACCCAAAGCCTCTCTGCGCAGCCTCTCATGACCAACGGTTTGCCTACTCCAGTGACGTACGCGCCCCAGAGCTTCCCTCCAGCCGTTCTGGACGCCCCTGCTTTTGTCCCAATGCAGGGTTACCCTCAACCTGCATCCACACAGCCTATGCCCCCCCACGTCTACATGCCACAAATGTCTGTGCCAGATGGTTATGGCTCAGAAGTTGGAGCCTCGCAGGTTTATAGTTATGCCCCCTCACAAAGCTACGCTCCTTCTCAGGGATATGCTCCATCACAAAGCTACGCGCCATCACAGAGGTACGCCGGACACCGATATTCGACACGCTCCCGAACGTCAGGGATTGAGATTGACATTCCTGTCCTCACAGATTGAGATTGGCTGTCTAAGGAGATTTCAAATTAAAAAGGTCATATTTAGAAATTAGACAACAACTCTGATGGTAAATTTAAAGTCATGTAAATGGTTAATTAGAAAGAACAGCCTTCATTTGGTTAATGTCGCCTCTAATTCTTAGGACTAAAAATGGCCAGAACTATCAGAAAAGTGATTTGAGCAGATAGAAAGGTGACATTCTCATATAACCTCGTATTACAACTAAAGTCTGCAGTAAAGCAACTCTGAACACATCAAACCTTGAAGCAGATGAGCTACTGCAGAAGAAGAGCAAACTGGTGACACTCCTGTCTGCTAAGAAAACTGAGGTTCCCATTGACATGAGCTCAACAAAACTATGACAGAAAATTGTAGGAAGGTTGGCTATTCTGATACATCTTAGGCCCATTTCAGTTCTACCTCTTAAACCCTTCCACTTACTCTTGCCCCTCCAAGCAAAAGAGAATCAGTAAGCGAAAGGGCCGTATTTATCGAATCAAAAAGGTCATAATTAGAAATTAGAGAACAACTCCGATGGTAAATTTGAAGTCATGTAAAAGATTCAATTAAAAGATTAGACTTTATTCAGTTGATGTCGCCGGTGCCTCTTAATTCTTAGTACTGAAAATGGCCAAAAAAGGAAAAATCGATCAAAAAAATTGTTTGAGCAGATAAAAAGGTGACATTTTCTCAAATAACCTCTTATTACGATTAAAGTCTGCAGGAGAGCAACTCTGAACACGGCAAACCTTGAAGTAGATGAGCTACAGCAGCAGCAGAAGAAGAGCACTCTGGTGACACTCCTGTCTGCTAGGAAAACTGATGCTCCAATTGACATGAATTCAACAAAACTCGATATCAGATCAGGCAACCATTTTACAATCTTCTGTTAACACTTAGGCCCAATCCAGCCTTCCACTCACTGATTATTTTTTGCTTTGAGGCGTAGTAAGGCGAAATGCCCTCCAATTACAAAGGTCATAATTAGAAATTAGAGAACAACTATGATGGTAAATTTGAAGTCATGTAAATTGTAAAATTGAAAAATAAGCCTTTATTCAGTTGATGTCACCAATGCCTCTTAATTCTTGGCACTGAAAATGGCCAAAAAAGGGAAAAAAACAACCCGAAAAGCGATTTGAGCAGATAGAAAGGTGATGTTGTCTCAAATAACCTCTTACTACAACTAAAGTCTTCAGGGGAGCAACTCTGAACACATCAAACCTTGAAGCAGATGAGCTACAGCAGCAGAAGAAGAGCACACTAGTGACATTCTGGTCTGCTAAGAAATCTGATCATAATTAGAAATTAGAGTACAACTCTCATGGTGAATTTGAAGTTATGTAAATGGTTAAAGATACGCCTTTATTCAGTGGATGTCGCAGATGCCTCTTAATTCTTAGCACTAAAATGGCCAAAAAGGGAAAAAAGGTCATGAAAGCAGTAACACTAGCTGAAGTTGTGCATCTCGCTTTATAATAGTTTCATTCATAAAACACAAGCAAAACAAACTTGTTAATAATTTCACTGAGTATGTCAAGGTGACTTCACTTAATTCATACTCATGTTTCGTGTTGTTACTCTGCTTTTAAATGTCAGTAGAAACACTGAATATAAAGTTGATTTTAAGCACTGTTTTAACCTTTAAGCGAATATTTCTGCTAATATCTAAATGTGACTATTACAGTAAATATTAGAAAGAGATGTAACACTGACTGCAGAAACGGTATTATTCTCAGTGCCATGAAGTTGGACGTTTTCTTTTTTTAAGCTTAGTGAATATGTTGGTTTATTGCTCTAATATCTGTACATCATGTTTTCATGGGGTTTTACGCAGATTTTACATATCTATATTTGAAGGACTGAGTTTTATCAATGACTTTTCTTTGACTTATTTTTTTGTTGTTGTTGGTTTAAAACTGTCACAATGTTAAACGAACACCTAGTAGAGGTTTTTTATATATACATGGAAGAATCATCTCTGCCTGATGCCTTTGTGCAGCTTAACTCTTGTTTCCAGAACTGTACTTCCACTTATTAATTTAATCCTTTATAATGAGCCTTACATCAACAAGCCATTAACTAAACACTGCGTTGCATTCCATTGTTTTCTTATAAATGTAAATGTTATCTTATTGTTGTTGTTGTGTTTTAAAGGTGTCACCAGCGTATTCATCATTGTGCAACTCGGCATTTGAATAATGAATGCTCCATTAATGTGTTTGTTTACTGTTAGTTTCTTAGCTGAATTGAGGAAAACACGCTAATGTCTTAAACTTGATCTTCGCCTATTGAATATTGCACATATCTATTTCAGTTTGCCTGTTTCTGCAAAGCTCTGCAGCAAAATGTTAATTTTAATCACTGTGTAGTTTACTAATGTCTTTGTTTTTTTTATTAAAGTGCAGTTTATTGAAAAAAAAA
Gene targeted:
claudin 12
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (6)
Pigment: (6)
Eye: (7)
Vasculature: (10)
none: (1)
- head count
(14.29%, dose:3ng, p53:4.5ng, days: -)
- eye small size
(16.67%, dose:4.5ng, p53:6.75ng, days: -)
- head dysplastic
(16.67%, dose:4.5ng, p53:6.75ng, days: -)
- heart edematous
(14.29%, dose:6ng, p53:9ng, days: -)
- heart straight angle
(14.29%, dose:6ng, p53:9ng, days: -)
- tail short length
(14.29%, dose:6ng, p53:9ng, days: -)
- cardiac ventricle large size
(14.29%, dose:9ng, p53:13.5ng, days: -)
- pigment cells [propose more pigmetation]
(28.57%, dose:9ng, p53:13.5ng, days: -)
- heart edematous
(14.29%, dose:9ng, p53:13.5ng, days: -)
- heart straight angle
(14.29%, dose:9ng, p53:13.5ng, days: -)
- tail coiled
(14.29%, dose:9ng, p53:13.5ng, days: -)
- pigment cells [propose more pigmetation]
(57.14%, dose:12ng, p53:18ng, days: -)

Images