MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3032    
Morpholino sequence: CTCGGAGAGGAAAAAGAGGACTATC
Find in Genbank
Target name: zgc:110044
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TTGGCTCTGGAAGGAGCGCGAGGGCAGCTGTTACAGCGTCCCTCTCGCGCAGCTGTTCCACAATCTCCAAAACACTGATCGCGAATACGGATCCAAAGTGTGCGGATAGTCCTCTTTTTCCTCTCCGAGACGCAGCGCAGCATCAGCCCAGGGCATCCAGCCGACATGGCCTCATCCGTGAGCGGAGCAGAGGAAGTGCGCGTGTCGGCGTTGACGCCCCTGAAGTTGGTGGGTCTGGTGTGTGTTTTCCTCGCGCTGTGCCTGGATGTCGGGGCCGTGCTGAGTCCGGCGTGGGTCACCGCCGATGACCAGTACCACCTGTCCCTGTGGAAGTCGTGCTCGAAGCCCGCTGCCTCCGCGACCTGGCGGTGCAACAGCACACTGGGGACCGACTGGCAGATCGCCACATTGGCTTTGCTGTTGGGTGGAGCGTTTCTTATCCTCCTCTCCTTCCTGGTGGCCCTGGTGTCTGTTTGCATTCGTTCCAGGAGACGCTTCTACCGACCGGTCGCGATTATGCTCTTCGCTGCAGTGGTCCTGCAGGCCTGCTGTTTGGTGCTGTATCCCATCAAGTTCATCGAGACCATCAGTTTGAGAATATACCACGAGTTCAACTGGGGGTACGGTCTGGCCTGGGGAGCCACCATCTTCTCCTTCGGCGGAGCCATTCTCTACTGCCTGAACCCTAAGAACTACGAAGATTATTATTAAACCACAGCCACAATGCACTTCGATGTCCCTNTTCACTGTTGTGATAGCAGCTCACGCACTGAACTGACACAAAGACCCTCAAAATGCGGGGCAGACGCCGAGCTGATAGATCCATATTTTGATTCTCCTTCAGAATGCTCTATTAT
Gene targeted:
zgc:110044
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (2)
Eye: (5)
Vasculature: (4)
Pigment: (3)
- tail coiled
(14.29%, dose:1ng, p53:1.5ng, days: -)
- dorsal aorta [proposed pooling]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- eye absent
(12.5%, dose:1.5ng, p53:2.25ng, days: -)
- eye dysplastic
(13.33%, dose:1.5ng, p53:2.25ng, days: -)
- eye medial
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- eye small size
(13.33%, dose:1.5ng, p53:2.25ng, days: -)
- heart edematous
(28.57%, dose:1.5ng, p53:2.25ng, days: -)
- head dysplastic
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- head small size
(12.5%, dose:1.5ng, p53:2.25ng, days: -)
- tail coiled
(16.67%, dose:1.5ng, p53:2.25ng, days: -)
- tail short length
(12.5%, dose:1.5ng, p53:2.25ng, days: -)

Images