MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3027    
Morpholino sequence: TTGCTCCAGGTCTAAAGAACACTTC
Find in Genbank
Target name: TC268008
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TCTTTCTGAGTCCGAGACACACACCTGCTTTAGGGCTGCCTTAAATCAGCTGTTAAACCCCTTCAGTTGAAGTGTTCTTTAGACCTGGAGCAAGATGCTGCTTTTCTTCTGTCTGCTCTCTGTGACATTAGCGGCTGCTGAAGTGGGTCTCAGTGGTAAAACTCTTCTGTTCCCGACCGCTACTGACTCCAGTTATGTTAAACTCAATCCGAGAAAACCCCTGAGTCTGTCAGCGTTTACTCTCTGCATGCGTGTGGCGACGGAGCTGCCGGCCAAAAGGGAGATCATCCTGTTCGCCTACCGCACACCTGAAGTTGATGAGCTCAATGTGTGGAGAGAGAAGGATGGCCGTGTGGGTTTGTTTATTCAGTCTAGTAACGATGCAGCACTTGTGCGTCTTCATCCTCTCTCCACATTTCAGACTCACCTGTGCGTCACCTGGGAGTCTGCGACTGGTCTTACTGCTTTCTGGGCGGACGGTCAACGTAGTTTGCACCAAGTGTACAGGAAAGGTTACGCCATTCGTCCTGGCGGCACCGTCCTGCTCGGACAAGACCCAGATTCATTTGTGGGTTCCTTTGATGTAGATCAGAGCTTTGTGGGAGAAATTACAGATCTGCAAATGTGGGACTATGTGCTGTCCGGCACTCAGATTAAAGCGGTGTATTTAAACCAGGATAATCGTGTGAAGGGAAATGTGTTTGACTGGAACAGCATCAAATATGATATTTATGGAAATGTGCTTGTGGCTCCAGATAACTGACTGGATCAGCTGTAATATTCACCCAAGATTAACCAATCAATAGGACAATTGAAAATTAAAAAAAAA
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Pigment: (3)
Kidney: (4)
Eye: (4)
Vasculature: (7)
Morphology: (8)
- tail coiled
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- heart edematous
(42.86%, dose:4.5ng, p53:6.75ng, days: -)
- heart straight angle
(20%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein edematous
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- head large size
(30%, dose:4.5ng, p53:6.75ng, days: -)
- trunk coiled
(40%, dose:4.5ng, p53:6.75ng, days: -)
- tail coiled
(28.57%, dose:4.5ng, p53:6.75ng, days: -)
- cardiovascular system [propose absent flow]
(28.57%, dose:6ng, p53:9ng, days: -)
- eye small size
(10%, dose:6ng, p53:9ng, days: -)
- heart edematous
(23.81%, dose:6ng, p53:9ng, days: -)
- heart straight angle
(30%, dose:6ng, p53:9ng, days: -)
- notochord undulate
(50%, dose:6ng, p53:9ng, days: -)
- atrium large size
(28.57%, dose:6ng, p53:9ng, days: -)
- head large size
(20%, dose:6ng, p53:9ng, days: -)
- trunk coiled
(45%, dose:6ng, p53:9ng, days: -)
- tail coiled
(24.62%, dose:6ng, p53:9ng, days: -)
- tail short length
(28.57%, dose:6ng, p53:9ng, days: -)
- cardiovascular system [propose absent flow]
(42.86%, dose:9ng, p53:13.5ng, days: -)
- eye absent
(70%, dose:9ng, p53:13.5ng, days: -)
- eye small size
(70%, dose:9ng, p53:13.5ng, days: -)
- heart edematous
(35.71%, dose:9ng, p53:13.5ng, days: -)
- common cardinal vein [proposed pooling]
(28.57%, dose:9ng, p53:13.5ng, days: -)
- head small size
(70%, dose:9ng, p53:13.5ng, days: -)
- tail coiled
(39.02%, dose:9ng, p53:13.5ng, days: -)
- tail edematous
(42.86%, dose:9ng, p53:13.5ng, days: -)
- cardiovascular system [propose absent flow]
(71.43%, dose:12ng, p53:18ng, days: -)
- eye absent
(37.5%, dose:12ng, p53:18ng, days: -)
- fins absent
(37.5%, dose:12ng, p53:18ng, days: -)
- heart edematous
(50%, dose:12ng, p53:18ng, days: -)
- tail coiled
(40%, dose:12ng, p53:18ng, days: -)
- tail edematous
(71.43%, dose:12ng, p53:18ng, days: -)
- tail short length
(25%, dose:12ng, p53:18ng, days: -)

Images