MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3026    
Morpholino sequence: TTGATGGACAGACAAGAACACCTGA
Find in Genbank
Target name: apoeb
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CTCTGGAAAAAAAAAAGAAAAGATGCGGACTTCGCACAGTTGCTGCAGTCAGTGACGCGTGGGATGATGCGCGAGCCCCGAACAAAAGACGAATCACGTGGCTGCGATTGTGAATACAGCGGGTGCGTCCCGGGACAGTATAAAAGACCTGCCATCCAAACTTCTCCACACGGAGAAAAATCACGCTTCTCAGGTGTTCTTGTCTGTCCATCAACATGAGGTCTCTTGTGGTATTCTTTGCTCTGGCAGTTTTAACTGGCTGCCAGGCTCGTAGCCTGTTCCAGGCTGATGCCCCTCAGCCCAGATGGGAGGAGATGGTGGACCGTTTCTGGCAGTATGTGTCTGAACTCAACACACAAACTGACGGCATGGTGCAAAACATCAAGGGCTCCCAGCTCAGCAGAGAGCTTGACACACTAATTACTGACACCATGGCTGAACTGAGCTCATACAGTGAAAATCTCCAAACCCAGATGACCCCATACGCCTCTGATGCTGCTGGTCAGCTCAGTAAAGATCTTCAGCTCCTGGCTGGAAAACTCCAAACTGACATGACCGACGCTAAGGAACGCAGCACTCAGTACCTGCAAGAGCTGAAGACCATGATGGAGCAGAATGCAGATGACGTGAAGAACCGTGTCGGCACCTACACACGCAAACTGAAGAAACGCCTGAACAAGGACACAGAGGAGATCCGCAACACCGTAGCAACCTACATCACTGAGAAGCAGTCCCGCGAGCAGCTGCAGGAAGTCATGGACAAGATCAAGGAGGCCACAGCAGCTCTTCCCACTCAGGCTTAAGAGCTCCACACTTACCTAGTGTTAACACCAAACAGAAAGAAGAACGGAGGCTTTGTGTTACTGAAATGTGCTTTTTTCATTCTGTGAGA
Gene targeted:
apolipoprotein Eb
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
apoe
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (6)
none: (2)
Eye: (12)
Vasculature: (12)
Pigment: (4)
- eye small size
(50%, dose:1.5ng, p53:2.25ng, days: -)
- head small size
(50%, dose:1.5ng, p53:2.25ng, days: -)
- tail coiled
(87.5%, dose:1.5ng, p53:2.25ng, days: -)
- tail short length
(50%, dose:1.5ng, p53:2.25ng, days: -)
- eye absent
(50%, dose:3ng, p53:4.5ng, days: -)
- eye medial
(100%, dose:3ng, p53:4.5ng, days: -)
- eye small size
(65%, dose:3ng, p53:4.5ng, days: -)
- head dysplastic
(70%, dose:3ng, p53:4.5ng, days: -)
- head small size
(80%, dose:3ng, p53:4.5ng, days: -)
- tail coiled
(45%, dose:3ng, p53:4.5ng, days: -)
- tail short length
(80%, dose:3ng, p53:4.5ng, days: -)
- cardiovascular system [propose absent flow]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- dorsal aorta [proposed pooling]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- extension short length
(90%, dose:4.5ng, p53:6.75ng, days: -)
- eye absent
(56.67%, dose:4.5ng, p53:6.75ng, days: -)
- eye dysplastic
(60%, dose:4.5ng, p53:6.75ng, days: -)
- eye small size
(50%, dose:4.5ng, p53:6.75ng, days: -)
- heart edematous
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein [proposed pooling]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein edematous
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- head small size
(45%, dose:4.5ng, p53:6.75ng, days: -)
- tail coiled
(58.82%, dose:4.5ng, p53:6.75ng, days: -)
- dorsal aorta [proposed pooling]
(20.83%, dose:6ng, p53:9ng, days: -)
- eye absent
(57.14%, dose:6ng, p53:9ng, days: -)
- eye dysplastic
(40%, dose:6ng, p53:9ng, days: -)
- eye small size
(51.47%, dose:6ng, p53:9ng, days: -)
- heart edematous
(25%, dose:6ng, p53:9ng, days: -)
- common cardinal vein [proposed pooling]
(37.5%, dose:6ng, p53:9ng, days: -)
- head small size
(30%, dose:6ng, p53:9ng, days: -)
- tail coiled
(37.04%, dose:6ng, p53:9ng, days: -)

Images