MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2089    
Morpholino sequence: GACAAATCCACATCCACACGTACGA
Find in Genbank
Target name: hpse
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CGTCCCGAAGCTACGCCCATCAACCGCTGCCGTGGGATGTTTTACAAAATATAGTCATAAACCAATTCC TTTTTCATCAGTCTATCTAGAAATGAGGAAGTATCTCAGCGTTGTCAAATTCGCCTGGGTGTTTCTGATG AAACTGCAGCAGTAAATGAGGAGGACACCGGCAGTCTGAACAGATGAAGTCCGCAGCCACAGCGCTTTCC ACAATATTCGCTCTTCTTTTGTTTGACCCGGTTTACCTCGAGGCTAAAACAGTGATTTCTGTGGATGATG TTGGTCAGTTCGTACGTGTGGATGTGGATTTGTCCCGTGTTGCCCGACGGGTGGATGAAAGGTTTCTTTC CGTGGCTATTGATGCGAGTTTATTAACCGAGGAGAAGTTTATGAACCTACTGAATTCACCAAAGTTAAGA ACCCTCGCCAAAGCTTTGACCCCAGCCTTTCTGAGATTTGGAGGCACCAAACAAGATTTTCTAAAATTCA GTCCACGCGGAAGATATTATTTACAAGGCAGAGAAAACGGCAGCAGCGCTTTTCAAGGAAATGTATGTAT GAGACTTGAATTGCCTCCACTGCTGGAAAACCGGTTAAAGCAGGAATGGGTCCAACAGTCAAAATCTTTA CTTCTGAAGGAACTGGACGGAAAATACCGCAACACCAAATTCTCTGAAGATTCTGTGGACTTGCTGTACT CTTTTGCAAACTGCTCTGGTTTGGAGCTCATCTTTGGGTTGAATGCTTTGCTGCGAACAAGCAGAAACTG TTGGGACAGTGGGAATGCAAAACTGCTGCTCAAATACTGTGAGTCCAGGCAGTATATGATGTCCTGGGAG CTGGGCAATGAACCCAACAGTTATGAGAAGAAAGCAGGGGTCAGAGTGGATGGATTTCAACTTGGTCGGG ATTTCATGCATTTGCATCAAATCCTTCAGGAATCCACAATCTACAACTCAACAGGACTTTATGGACCAGA TGTTAGTCAACCAAAAGATCACCGCAAGGATTTGTTAACTGGATTTTTGGAGACTGGAGGAAAGGTCATT AATGCATGCACTTGGCATCACTATTATGTTAACGGTCGAGACACATCTTTAGAGGATTTTCTTGACCCTG AAGTGCTCGATTCTCTGGCAACAAAAATTAACGAGGTCCTCGAGATGGTTGAAGCTGTTTCCCCGGGGAA GAAGGTTTGGCTGGGAGAGACCAGTTCAGCATATGGTGGAGGTGCCGTTGGTCTCTCTGACACATTTGTG GCGGGTTTTATGTGGCTGGACAAACTGGGGCTTGCTGCTAAGCTTGGTTTGAATCTTGTTATCAGACAGG TTTTAATTGGTGCTGGCACATACCATTTAGTGGATGATAACCTCGATCCTCTTCCAGATTACTGGCTGTC GTTGCTCTTCAAAAGGCTTGTTGGTCAAGAGGTCTTAAAAGCAGACGTTACTGTCAATTCAGGACTAAAG AAACCAATACGGGTTTACCTTCACTGCACAAACAAAAAGAGTACACAATACAAAGAAGGAGCTGTGACCT TATTTGCCTTAAACCTGAACAAAAATGAAGCCACGATTAATCTTCCAGCTCATTTGACCAACGGCTCCAT TGAAGCGTTTGTGCTGCAGTCAGATGAGGCTGGCGAACAAGGCCTTTATTCCAGGTCAGTTCGTCTGAAT GGAGAGCTGTTGAAGATGGTGGATGATCGAACTCTTCCTCCGCTGACAGGACGTGAGCTGCCGTCTGATG AACCCATCAAGCTGCCCGCCTTCTCATTTGCATTCTACGTTCTGATTAATGCACAAGCTGCAGTATGCAA ATGA
Gene targeted:
heparanase
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Blood: (1)
Kidney: (3)
Pigment: (8)
Toxicity: (8)
Eye: (4)
Morphology: (4)
Vasculature: (8)
- head [proposed pooling]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- tail coiled
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- dorsal aorta [proposed pooling]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- eye absent
(5%, dose:4.5ng, p53:6.75ng, days: -)
- eye dysplastic
(5%, dose:4.5ng, p53:6.75ng, days: -)
- eye small size
(5%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein [proposed pooling]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- iridophores absent
(5%, dose:4.5ng, p53:6.75ng, days: -)
- iridophores decreased number
(5%, dose:4.5ng, p53:6.75ng, days: -)
- head [proposed pooling]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- head small size
(5%, dose:4.5ng, p53:6.75ng, days: -)
- tail short length
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- eye small size
(10%, dose:6ng, p53:9ng, days: -)

Images