MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2088    
Morpholino sequence: TTACCATACCATGAGGAGAATACTG
Find in Genbank
Target name: MLF1IP
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GI|38568085|EMB|BX088718.7| ZEBRAFISH DNA SEQUENCE FROM CLONE DKEY-185E18, COMPLETE SEQUENCE LENGTH=192836 SCORE = 50.1 BITS (25), EXPECT = 1E-04 IDENTITIES = 25/25 (100%), GAPS = 0/25 (0%) STRAND=PLUS/PLUS QUERY 1 TTACCATACCATGAGGAGAATACTG 25 ||||||||||||||||||||||||| SBJCT 24265 TTACCATACCATGAGGAGAATACTG 24289
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (4)
Eye: (6)
Vasculature: (6)
Pigment: (4)
- head dysplastic
(57.14%, dose:1.5ng, p53:2.25ng, days: -)
- head [proposed pooling]
(14.29%, dose:3ng, p53:4.5ng, days: -)
- head dysplastic
(85.71%, dose:3ng, p53:4.5ng, days: -)
- head dysplastic
(42.86%, dose:4.5ng, p53:6.75ng, days: -)
- pigment cells [propose more pigmetation]
(100%, dose:6ng, p53:9ng, days: -)
- eye dysplastic
(100%, dose:6ng, p53:9ng, days: -)
- head [proposed pooling]
(28.57%, dose:6ng, p53:9ng, days: -)
- trunk [proposed pooling]
(28.57%, dose:6ng, p53:9ng, days: -)
- cardiovascular system [propose decreased flow]
(14.29%, dose:9ng, p53:13.5ng, days: -)
- eye absent
(12.5%, dose:9ng, p53:13.5ng, days: -)
- immature otoliths count
(12.5%, dose:9ng, p53:13.5ng, days: -)
- head dysplastic
(25%, dose:9ng, p53:13.5ng, days: -)
- tail coiled
(20.83%, dose:9ng, p53:13.5ng, days: -)
- head dysplastic
(43.75%, dose:12ng, p53:18ng, days: -)
- tail coiled
(12.5%, dose:12ng, p53:18ng, days: -)

Images