MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2087    
Morpholino sequence: TCCTAATGTTTCTCTGGGGTTTCTG
Find in Genbank
Target name: C3orf6
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CATCAGTCTGTCAAACAATAACCTTCAGAAACCCCAGAGAAACATTAGGATGGCTGATTTTAGTATTGATCAGAAAAACCTGCCTGGCGTAAAAGAGGTGTGTCGGGACTTTGCCTTGCTCGAAGACCACTGTCTGGCCCACAACCTTCAGGAACAGGAGATTGAGAGCCACTTGGCATCCAACGTGTACAAGAGCCGCCTGGCACAGCAGGACCTGCAAGTGGCCAAACGTCTGCAGCAGGAGGAGGACCTGCGGGCCAAAGCCGAGAGCCAGAGACAACACCGTCGCATCGAACGCATTGACAATGAAATTGCTCAGGAGATTCAAGACCAACTGGTCCGACAGGCTGAACAGCAGCGGCAGCAGGAGGAGAAAGACGAGGCCATTGCACGAAAGCTGCATGAGCGAGAGATGAAGGAGGAGAGGAAACGACAGAAGCAGATGGAAACAAACATTGAGGAGGAATTCTATGAAGACAAAGGCCGCAAGGTACGAGGAGAGTATGGCATGAAGGAAGCAACACATGGACTGGCCCAGTTAGACCTACATGACCAAGAGTTCAGAGACCTGGAGGTGGCACGCAAACTACAAGATGAAGAGTTAAAGGCTGTCCAAGTTGACAAACGAGCAGCTCAAGTTGCACAAGATGAGGAAATAGCCCGACGGCTAATGGAGGAAGAGAAAAGAGAATATAAAAAATCGAAAGATAAGGAAAAACAAGTGATTGAGAGGAGACGACCCGAGCTAGAATACAAACCAGTGCAAGAAGATGTAGTACGACCACGAACACGAGAAGAGGTGCGTAGCAGAGAGGAGGAGTACCAGAGAGCACGCAACCACAAACCTGCGAGG
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (10)
Vasculature: (17)
Eye: (19)
Pigment: (14)
Toxicity: (10)
Blood: (2)
- cardiovascular system [propose absent flow]
(14.29%, dose:2ng, p53:3ng, days: -)
- pigment cells [propose more pigmetation]
(85.71%, dose:2ng, p53:3ng, days: -)
- eye small size
(20%, dose:2ng, p53:3ng, days: -)
- heart edematous
(33.33%, dose:2ng, p53:3ng, days: -)
- heart straight angle
(42.86%, dose:2ng, p53:3ng, days: -)
- head [proposed pooling]
(14.29%, dose:2ng, p53:3ng, days: -)
- head small size
(20%, dose:2ng, p53:3ng, days: -)
- trunk [proposed pooling]
(14.29%, dose:2ng, p53:3ng, days: -)
- tail [proposed pooling]
(14.29%, dose:2ng, p53:3ng, days: -)
- tail coiled
(41.18%, dose:2ng, p53:3ng, days: -)
- tail short length
(41.18%, dose:2ng, p53:3ng, days: -)
- cardiovascular system [propose absent flow]
(28.57%, dose:3ng, p53:4.5ng, days: -)
- pigment cells [propose more pigmetation]
(85.71%, dose:3ng, p53:4.5ng, days: -)
- pigment cells colorless
(14.29%, dose:3ng, p53:4.5ng, days: -)
- eye absent
(14.29%, dose:3ng, p53:4.5ng, days: -)
- eye dysplastic
(14.29%, dose:3ng, p53:4.5ng, days: -)
- eye small size
(11.11%, dose:3ng, p53:4.5ng, days: -)
- heart edematous
(28.57%, dose:3ng, p53:4.5ng, days: -)
- heart straight angle
(21.43%, dose:3ng, p53:4.5ng, days: -)
- common cardinal vein [proposed pooling]
(42.86%, dose:3ng, p53:4.5ng, days: -)
- common cardinal vein edematous
(14.81%, dose:3ng, p53:4.5ng, days: -)
- head [proposed pooling]
(26.32%, dose:3ng, p53:4.5ng, days: -)
- tail coiled
(13.16%, dose:3ng, p53:4.5ng, days: -)
- eye dysplastic
(14.29%, dose:4ng, p53:6ng, days: -)
- eye small size
(10%, dose:4ng, p53:6ng, days: -)
- tail coiled
(22.73%, dose:4ng, p53:6ng, days: -)
- pigment cells [propose more pigmetation]
(85.71%, dose:4.5ng, p53:6.75ng, days: -)
- heart straight angle
(42.86%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein [proposed pooling]
(42.86%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein edematous
(57.14%, dose:4.5ng, p53:6.75ng, days: -)
- head [proposed pooling]
(42.86%, dose:4.5ng, p53:6.75ng, days: -)
- tail coiled
(20%, dose:4.5ng, p53:6.75ng, days: -)
- eye dysplastic
(16.67%, dose:6ng, p53:9ng, days: -)

Images