MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2085    
Morpholino sequence: ATTTTGCTGGTCATTTTGCCTAAGT
Find in Genbank
Target name: PPBP
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GI|41411306|EMB|BX323990.6| ZEBRAFISH DNA SEQUENCE FROM CLONE DKEYP-69B4 IN LINKAGE GROUP 1, COMPLETE SEQUENCE LENGTH=199414 SCORE = 50.1 BITS (25), EXPECT = 1E-04 IDENTITIES = 25/25 (100%), GAPS = 0/25 (0%) STRAND=PLUS/MINUS QUERY 1 ATTTTGCTGGTCATTTTGCCTAAGT 25 ||||||||||||||||||||||||| SBJCT 74659 ATTTTGCTGGTCATTTTGCCTAAGT 74635
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Pigment: (4)
Toxicity: (4)
Kidney: (2)
Eye: (2)
Morphology: (3)
Vasculature: (5)
- head small size
(3.77%, dose:1.5ng, p53:2.25ng, days: -)
- head small size
(6%, dose:3ng, p53:4.5ng, days: -)
- head small size
(4.88%, dose:6ng, p53:9ng, days: -)

Images