MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2082    
Morpholino sequence: GAAGCTGAACATTGAGGAAATCGAT
Find in Genbank
Target name: zgc:92731
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GACTTGAATGAGGTGCGCGCAGACGCTGGAAAGTAGTACAAACCGTCTGGGAATAACGGGAATACTGGA GCACAGCGGCCAGACAGCGGGCCGGGGGCGGGGGGACGGCGGTTAGAGGACGGTAGACACAGAATAGGAA AAGCCTGCGTCAATGTTTTTATCCGACAACGCGCGCTGAGGCGACCGACTAACCAACCGACAAACCGTCC GTTTTTCACATCGATTTCCTCAATGTTCAGCTTCATGGGTCTGACGAACGGAACCACCGACACCCTCGCC AATGTCTCCTGTACATGTAACTGCCAGAGATCCACTTCATTCCAGAGTATGGCGATCTCCCAGCTGGAGT TTGTTCAGATTCTGGTGATCGTGGTGGTGATGATGATGATGGTGCTGGTGATCACGTGTTTGCTGAACCA CTACAGACTCTCAGCGCGATCTCTGATGTCCAGACACACACACGAGCGCAGACGACACCTGCCCCTGCCC TCGGAGGGCAGTCTGTGGTCTTCTGATGGGCCAGGCTCTTCTAGTGCCATGAGTGAGGTTTACACTCCTC GAGCGCCGGATAGAGTGCCGTCGTTCCTGCAGCGTGAGCGCGTGTCCCGCTTCCAGCCTACCTTCCCATT CCTCCCTCCAGTGATCGAACTGCCTCCGACCATCGCTCTGTCTGACGGCGAGGAACCTCCGCCGTATCAG GGGCCATGCACGCTTCAGCTGCGGGACCGTGAGCAGCAGCTGGAGCTCAACCGGGAGTCTGTGCGCCCGC CGCCCAACCGCACAGTGTACGACAGCGCGCTCACACACACACACACACTGATACAGGCCCGTAGTACACT CATATGCACTTTGTACACATGACCACACACACACAGACACACACATGCAGGACTTGCGTTCTCTCTAATG GGCAAACTCAGCTAAGAATCAAAGAACACTGAATCCTGTTCATTCAAAAACGCCTAGCAAAATCCCTTTG TTAAGCTGCTTTGTGTTAAAAACTGATGTTCAATGTTCAATCAAATGAAATAATAAAAATAAAAAAACTT TCATACTAAAAAAAAAAAAAAAAAA
Gene targeted:
zgc:92731
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (5)
Toxicity: (7)
Pigment: (4)
Eye: (3)
Morphology: (4)
Vasculature: (4)
- heart edematous
(25%, dose:3ng, p53:4.5ng, days: -)
- eye absent
(10%, dose:4.5ng, p53:6.75ng, days: -)
- eye small size
(10%, dose:4.5ng, p53:6.75ng, days: -)
- iridophores decreased number
(20%, dose:4.5ng, p53:6.75ng, days: -)
- eye dysplastic
(87.5%, dose:6ng, p53:9ng, days: -)
- eye small size
(50%, dose:6ng, p53:9ng, days: -)
- iridophores decreased number
(50%, dose:6ng, p53:9ng, days: -)
- head [proposed pooling]
(14.29%, dose:6ng, p53:9ng, days: -)
- eye dysplastic
(84.62%, dose:9ng, p53:13.5ng, days: -)

Images