MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3015    
Morpholino sequence: CATTCTGCTGTCCGACACAAACTAA
Find in Genbank
Target name: TC280370
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CTGTTTGGCCTACTGGTTTTTTTCTTTTGGCTCCGTTTACGGAAGTGGGTCGTCATTATTTACTAAACGGGACCAGTACGATATCGATCATCTGTAGATTAGATTATTTTGTGTTAGTTTGTGTCGGACAGCAGAATGCGCTCGGCCTGGCTGCTGTCGGCCGGCTGTGTGCTGTGGGTCTGCTCTCTGACAGCCGCTATTGAGCCCATCAGCACCAGTATAGCGGTCGGGATGGCAGCGGCTCTGACGGGCTTTCTGGCCGGATATCAGAACATGTTTTATTACTTCAATGAGTGCTGCAGACCCGAGTGGATCTCTTACAACAAAACAGGCCTGAAGTATGACCTGGACACAAAGCTTTATGGGCAGCACGTCGCAGGTCAAGTCATCCTGAAAGCCGTCACAGGCTTCATGAACAACAAAAAACCAAAGAAACCGCTGGTTCTGTCCCTGCACGGCTGGACCGGCACCGGGAAGAACTTTGTGAGCCAACTATTGGCTGAAAACATTTACGTGAAAGGCATGGAGAGCAGCTTCGTCCATCTGTTTACAGCAACAGCACACTTTCCTCATGAGATCCACATAGACACCTACAAGACGCAGTTACAGGATTGGATACGAGGAAACGTTTCCATCTGCCCTCGTTCCATGTTCATTTTCGATGAAATGGATAAAATGCATCCCGGGTTGATCGACAGTATAAAGCCGTACCTGGATTTTTACGATAACCTGAATGGAGTGTCTTACAGAGAGGCCATCTTCATCTTCCTCAGTAACGCCGGTGGTGAGAACATCGTTCAGGTGGCTCTGGATTTCTGGAAGGACGGCAAAGAACGAGAAGAGGTCCAGCTGAAGCATCTGGAGACGGCGCTTTCACTGTCTGTCTTCAACAACAAAAACAGTGGTTTCTGGCACACCAGTCTGATCGATAAGAACCTGGTGGATTTCTTCGTGCCGTTTCTCCCTCTGGAGTACAAGCACATCATTCAGTGCGGTCTGGCGGAGATGATCGCCAAGGGGCATTCGCCTGACAAAGAAGTGGTGGAAAAAATGGCCCACGACCTCAACTATTTCCCTAAAGAGGAGCGCGTTTTCTCCATGCAGGGCTGCAAAGTCATTCCCAGCAGACTGGACTTCTATATCTGAACGAGAAGAGACAGATGAGACTCTTTATAATTGACAGAAATGGAGGAATTGAGAGTAAACCATGCTCATTAAAGACTCTCAAGAGTGTTTTTATCCAATCACACGTCTTTTATACAACAATGGACTGTTTTATTAATGTCGAATCAGCTGCTCGTGTCCCTGTTTTAAAGGGTGTATGTTTAAAGATGATGAATTTGCAGCGTACACTTTTTTAAAAAACGACTTTGCACATTATGGAGCTCCTGTAAAAAAAAAAAAAACACTGGTGATTCTATGAAGCATTATTTGCTATCATGATTTATATATAAATTGTACTTTGTATGTCAAAAGCACTAATTTGCCTTCATCTTCAATTATCACAGATGTTTATTACAGCCTTTTTTGGGGGGTTTTCGGCTAAGCAATGTTTAGAATGAAAGTGATCGTTAGATAAGTCACATGACCTTAAAAGCTTTAATTTTCCTAATTTGTCAGGATTTACCATTTTTGTTAAGTTTCTGCCTCACAGTTTGTAGTGTTGGTGGTTTATAGTTGAAGATTTTGAGTAAATGTGTGCCTTTATCTCAATAGAGAGATTTAAGTTCAGCAAAAAACATGATTTTTTATTTCTTAAAGGCACTGATTATTAATTGATCTTGTTTTGAACGTAATGTAACATTTGAGACGTTTATGAAGACTTCTAAGATGCTCCAAGAAAAAAATGTGAAATACTTGAACTACAAGTTGATTTTTGATAAACGTGGAAGCTAAACTAAAAA
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Blood: (2)
Vasculature: (12)
Kidney: (4)
Toxicity: (14)
Pigment: (12)
Eye: (8)
Morphology: (3)
- head [proposed pooling]
(14.29%, dose:3ng, p53:4.5ng, days: -)
- tail coiled
(20%, dose:3ng, p53:4.5ng, days: -)
- eye absent
(10%, dose:4.5ng, p53:6.75ng, days: -)
- eye small size
(10%, dose:4.5ng, p53:6.75ng, days: -)
- heart edematous
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- common cardinal vein [proposed pooling]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- iridophores absent
(10%, dose:4.5ng, p53:6.75ng, days: -)
- head [proposed pooling]
(14.29%, dose:4.5ng, p53:6.75ng, days: -)
- blood decreased
(80%, dose:6ng, p53:9ng, days: -)
- eye medial
(10%, dose:6ng, p53:9ng, days: -)
- heart edematous
(57.14%, dose:6ng, p53:9ng, days: -)
- common cardinal vein [proposed pooling]
(57.14%, dose:6ng, p53:9ng, days: -)
- head small size
(7.14%, dose:6ng, p53:9ng, days: -)

Images