MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3011    
Morpholino sequence: GCATTTCGACTCTCAATTTCTCGAG
Find in Genbank
Target name: stc2
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GGGACTCTTCACACTGCTCTCTGTGTCATCTCGATCAGTCTCCGCATCAGATCTCAGGCTGACAGCCTGTGTCATTATAGCTCGAGAAATTGAGAGTCGAAATGCTGATTAAATTCACACTGTCCCTGCTGCTGCTCTCCGTATTGGGGGAAGTGGTAGGAACGGATAATGCTGATGTGCACGAGAGTCACCCCGAGAAACCGGCCAGTCAGAAGGGACGTCTCTCGTTACAGAACACAGCTGAGATCCAGCACTGTCTTGTGAGTGCAGGAGATGTGGGCTGCGGGGTGTTTGAGTGTTTCGAAAACAACTCGTGTGAAATTCGGGGCCTCCAGGAAATCTGCATGACCTTCTTGCACAATGCTGGCAAGTTCGACTCGCAGGGCAAGTCGTTCATCAAGGATGCACTGAAGTGCATGGCTCATGGCTTGAGGCACAAATTTAGTTGCATCAGCCGAAAATGCCTGGCCATAAAGGATATGGTCTTCCAGCTTCAGCGGGAATGCTACATGAAACACAACCTCTGCTCGGCTGCTAAAGACAACGTCAATGTCATGGTGGAGATGATACATTTCCAAGACTTATTTCCCAAAGGGCCTTACGTTGAGCTGGTGAACATTTTACTGGGCTGTGGACAAGAGGTGAAGGAAGCCATTACTCGGAGTGTGCGTCTGCAGTGTGAGCAGAACTGGGGCGCTTTGTGCGACAGCCTGAGCTTTTGTACATCTATGACTGCCGCTCCAGCATCCGGTGGCCATGAGCGACGTTCGGCGCTTACCTCTCATTCGGATGGGGAGCACCACAAGAGCGCTCGACAAGGAGAAAAAGAGAAGCCTGGCAAGGCTGGGTTTAATACCCAGATGAGAATTCGAAGCCAAGGCATGCGCCGCGCCAGTTTAGATGCCGTAGTTGCCGAGCAGGAAGACTCGAAGATAAGTGACATCCGAAGGTGAAATAGCAGGATCATCTAAACTGACCATGACACCCCAAATCCCAGACTTAACAGACTCCGCAATTCAACCCATACTCCCCTACACCTCCACACAGTCATTCCAGCACTCCCAAACTGTACATTTCGCAGGGTAAATGTGGTGCAGCTTTTTTGATACCCAGATTGTTAATTTTGTAGATTGCTTTTATTTAGTTCA
Gene targeted:
stanniocalcin 2
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Skin: (1)
none: (1)
Pituitary: (2)
Kidney: (4)
Pigment: (6)
Toxicity: (6)
Blood: (1)
Eye: (2)
Vasculature: (4)
- tail short length
(10%, dose:6ng, p53:0ng, days: -)
- head small size
(9.09%, dose:9ng, p53:13.5ng, days: -)
- common cardinal vein edematous
(75%, dose:12ng, p53:16ng, days: -)
- tail short length
(8.33%, dose:12ng, p53:16ng, days: -)

Images