MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3019    
Morpholino sequence: TAATATCTCCACAAAGAGTCGCCCA
Find in Genbank
Target name: efnb2a
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TGGGCGACTCTTTGTGGAGATATTACTTTGGAGTTTTAGTGATCGCGTGCAAGGTGAACCTGTCCCGCGCGCTCATCCTGGACTCCATATACTGGAACACCACGAACACCAAGTTTGTGCCGGGACAGGGTCTGGTGCTGTATCCGCAGATTGGGGATAAGATGGACATAGTTTGCCCACGTGTGGAAGGTGGTTCAATGGAAGGAGTGGAGTATTATAAACTCTATATGGTTCCTCTGGAACAGCTAAAGTCCTGTCAGGTCACAAAAGCAGACACGCCTCTACTCAACTGCGTCAAGCCAGACCAGGACGTCAAATTCACCCTCAAATTTCAGGAGTTCAGCCCAAACCTTTGGGGCCTGGAGTTCTTCAGAGGGAAGGACTACTACATTATCTCTACATCTAATGGAACAATGGAGGGGCTGGATAATCAGGAAGGAGGGGTGTGTAAAACCAAGTCGATGAAAATCATCATGAAGGTTGGACAAAACCCCTCTGATCCCATTTCCCCCAAAGACTACCCTACCAGTTACCCTCCCAAACACCCTGACTTAGGGGGCAAGGACAGCAAATCGAATGAAGTACTTAAGCCAGATGCATCTCCTCATGGGGAAGATAAGGGAGATGGAAATAAATCCTCATCAGTCATTGGCTCAGAGGTGGCCCTGTTTGCCTGCATCGCCTCAGCAAGCGTCATCGTCATCATCATAATCATCATGCTAGTTTTCCTTCTCCTGAAGTATCGACGACGTCATCGCAAACACTCTCCTCAACACGCCACCACGTTGTCACTCAGCACATTAGCCACGCCCAAGAGGGGCGGCAGCGGCGGCAACAACAACGGCTCAGAGCCGAGCGACATCATCATCCCACTGCGGACTGCTGACAGCGTCTTCTGCCCGCATTACGAGAAAGTGAGCGGCGATTACGGACACCCTGTTTACATCGTACAGGAAATGCCGCCACAGAGCCCAGCAAACATCTATTACAAGGTGTGA
Gene targeted:
ephrin B2a
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
efnb2, ephrin-B2a
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (2)
Toxicity: (8)
Pigment: (8)
Eye: (2)
Morphology: (10)
Vasculature: (6)
- tail coiled
(14.29%, dose:3ng, p53:4.5ng, days: -)
- dorsal aorta [proposed pooling]
(57.14%, dose:4.5ng, p53:6.75ng, days: -)
- tail coiled
(10%, dose:4.5ng, p53:6.75ng, days: -)
- dorsal aorta [proposed pooling]
(50%, dose:6ng, p53:9ng, days: -)
- common cardinal vein [proposed pooling]
(14.29%, dose:6ng, p53:9ng, days: -)

Images


Figure 1. Fusion of the dorsal aorta and caudal vein in the GFP::Fli1 and deRed::GATA embryo.