MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3024    
Morpholino sequence: ATGGTTTCTGCTCTTCTCCTTCTTC
Find in Genbank
Target name: zgc:112443
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GGTGCAATCGACGAGAAGAAGGAGAAGAGCAGAAACCATGCTTTCTGAAAAGTTTCACCTGCATCTGCTCACACTTTTGACCTTACTGACAGCACTGGCTCTCACAGATGTCGCAAGTGAGAGCAAGCTGGAAAAACTTTTGATGAAACGAGTGGACAGGGATGTAAAGCCGGCTGCAGCGGTGGCCGTTTCTCCCTCCAAAGCCAAAGAGTTCCTGACCTCCCTGAAAAGGCCTAAAAGAAACCTGTGGGACCGCAGCCGGCCGGACGTCCAGCAGTGGATCCAGCAGTTCATGTACATGGGCTTTGATGAAGCTAGACTGGAGACGGATCTGGCGTACTGGATGGATCAGCACCGCTCCAGTGATCAGGGTCGCCAGCATCACTATGATGAAAACGCTGCCCTGGGGCCTCGGGGAGCTGCTTCATACAGACACGGGGCAAATGTCAACTATGACTACTACTAGAACAGTCCATTCAACCAGAAACACGTCACCGATGCCAACAAGATGATTCTCTGCTCTGATTTACTGCACAGTGATCTCAGCTCTTCTTGCTTCTTTCTTTCTTTCTTCCTCTATAGTTTGTGCTTCCTTTTGTAAATGGAAATAAGAGGAGAACATGTATTTTTAGTGGAACAGTAAAGGATTCACATCTTCATCATTTACTTAATAAAAAAAAAATTGCAATTCCTGGA
Gene targeted:
zgc:112443
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Kidney: (3)
none: (2)
PAX2: (1)
Toxicity: (5)
Pigment: (11)
Eye: (8)
Vasculature: (11)
- midbrain hindbrain boundary decreased
(40%, dose:0.5ng, p53:0.75ng, days: -)
- heart edematous
(14.29%, dose:0.5ng, p53:0.75ng, days: -)
- pronephros absent
(10%, dose:0.5ng, p53:0.75ng, days: -)
- presumptive neurons neural tube decreased
(10%, dose:0.5ng, p53:0.75ng, days: -)
- tail coiled
(20%, dose:0.5ng, p53:0.75ng, days: -)
- cardiovascular system [propose absent flow]
(14.29%, dose:0.75ng, p53:1.125ng, days: -)
- heart edematous
(14.29%, dose:0.75ng, p53:1.125ng, days: -)
- heart straight angle
(14.29%, dose:0.75ng, p53:1.125ng, days: -)
- tail coiled
(10%, dose:1ng, p53:1.5ng, days: -)
- cardiovascular system [propose absent flow]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- dorsal aorta [proposed pooling]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- heart edematous
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- heart straight angle
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- head [proposed pooling]
(14.29%, dose:1.5ng, p53:2.25ng, days: -)
- tail coiled
(14.29%, dose:1.5ng, p53:2.25ng, days: -)

Images