MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3018    
Morpholino sequence: CTGTTGAACTGAGGTTAGAGTAGGA
Find in Genbank
Target name: TC271306
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CACGAGCCGGAGCGCAGCGCTCATCCCGCGGACGGACTGTCCTCGATCCTCGGCCAATTTACACCATAATTGCCAACGAACAGGCCGCCCCGCGCACACTAAACTAACGGCTTATCATCCTCCTCGGAGCGACACTGCGGATTTTGAGAAAAGCGCTATATTTCGGGCCAGCTCTCTGCTCGATCATGTTTGGGATTAATTTTTGAGGTACTACGATCTGAAGATCACATTTTTTCAGCGTGTGGAGCCTCAGATCTGCACCGGGACGAAGCGGAGGGTTTCTGTTCTCGTCTCGTGCGCTGTCGAAAACAGAAAAGAGAGCATGCGTGAGTAGCAGGATTCTGTGGCTCCTCCCCTCATCTGGAGCCCCTGCGCTGTAGGACACGAGACCCCCTTGCTTCTCCTACTCTAACCTCAGTTCAACAGGTGTGAAGATGAGGAAGTTTGCGTACTGTAAGGTGGTGCTGGCCACCTCTCTGGTGTGGGTGATGCTAGACATGTTCATCCTCCTCTACTTCAGCGAATGCAACAAGTGTGACGATAAAAAGGAGAGAGGATTGCCGGGGAGAGACACCGTGGTTCAGAGGCCTCATGATGGCCCCGGGGAGATGGGCAAACCAGTGGTCATTGCTAAAGACCAGCAGGAGAAGATGAAGGAAATGTTTAAGATAAACCAGTTTAACCTGATGGCCAGCGAGATGATTGCGCTCAACCGATCATTACCGGACGTCCGGCTCGAGGGATGTAAAACGAAAGTGTATCCAGATGATCTGCCGCGCACCAGTGTGGTGATCGTGTTTCATAATGAAGCATGGACCACACTGCTCCGGACGGTGCACAGCGTCATCGACAGGTCACCCAGACACCTGCTGGAGGAGATTGTCCTGGTGGATGACGCCAGCGAGAGAGACTTCCTAAAGCGGCAGCTGGAGCATTATGTGCGGAAGTTGGAGGTTCCTGTGAGGGTGGTGCGAATGGAGCAGCGCTCAGGCCTGATTCGCGCTCGGTTGAAGGGGGCATCAATCTCCACAGGTCAGGTGATCACCTTTCTGGATGCCCACTGTGAGTGCACCACCGGCTGGCTCGAGCCTCTGCTCTCTCGCATCAAACTTGACAAGAAAACCGTAGTGTGTCCCATCATTGACGTGATCAGCGATGACACCGTCGAGTACATGGCAGGCTCTGATATGACATATGGTGGGTTCAACTGGAAGCTGAACTTCCGCTGGTATCCTGTCCCACAGAGAGAGATGGACCGCAGGAAAGGAGACCGAACGCTGCCTGTCAGGACCCCGACAATGGCAGGTGGCCTCTTCTCCATAGACAGAGATTATTTCCAGGAGATCGGCACATATGATGCAGGAATGGACATCTGGGGAGGACAAAACCTGTAGATCTCATTTAGGATTTGGCAGTGTGGCGTTACGTTTGAGATTGTCACATGATCTCACGTCGGTCACGTGCTTCGTATAGCATCGCCTTACCCGTTCCCTGGTGGAACTGGCCAAATCATCAACAAGAACAACAGACGGTTGTTAGAGGTCTGGATGGACGAGTTCTAGAACTTCTTCTACATCATCTCACCTGGTGTGACGAAAGAGCATTATGGAGACATCTCAACCAGAACATCCCTGAGACAGAGACTGCAATTGCATGCCCTTCTCCTGTTACCTGGAAAATGTCTACCCAGACT
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Blood: (1)
Vasculature: (7)
Kidney: (2)
Toxicity: (6)
Pigment: (8)
Eye: (3)
- heart edematous
(25%, dose:6ng, p53:9ng, days: -)
- heart straight angle
(25%, dose:6ng, p53:9ng, days: -)
- tail coiled
(25%, dose:6ng, p53:9ng, days: -)
- tail short length
(25%, dose:6ng, p53:9ng, days: -)
- heart edematous
(11.11%, dose:9ng, p53:13.5ng, days: -)
- heart straight angle
(22.22%, dose:9ng, p53:13.5ng, days: -)
- tail coiled
(18.52%, dose:9ng, p53:13.5ng, days: -)
- tail short length
(11.11%, dose:9ng, p53:13.5ng, days: -)
- dorsal aorta [propose decreased flow]
(14.29%, dose:12ng, p53:18ng, days: -)
- eye absent
(10%, dose:12ng, p53:18ng, days: -)
- eye dysplastic
(10%, dose:12ng, p53:18ng, days: -)
- eye small size
(10%, dose:12ng, p53:18ng, days: -)
- heart edematous
(57.14%, dose:12ng, p53:18ng, days: -)
- heart straight angle
(57.14%, dose:12ng, p53:18ng, days: -)
- iridophores absent
(10%, dose:12ng, p53:18ng, days: -)
- tail coiled
(18.92%, dose:12ng, p53:18ng, days: -)
- tail short length
(57.14%, dose:12ng, p53:18ng, days: -)

Images