MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP3004    
Morpholino sequence: CAGAACAAAGGAATGAGGCAGGAAC
Find in Genbank
Target name: pnoc
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GTTTGGCCTACTGGAGCAGTTGAAAAACCCAGAAGCTGAAGATTGGACATATCCACCACACCTCAAGACTGAAAGTGACAGAGAGACCCCTTATCACCGACGGCAGAGAGCCCAGTGTCTGATCTGAAGTTCCTGCCTCATTCCTTTGTTCTGTGAAGAAGTCATGAAGACTCCATTTTGGACCCTGCTGCTCTTATGCTTGTGCGCTTCAAGTCACAGCGACTGCCAAGGGGACTGCTTAACCTGTGGACTCATCCTGCCTGAACACCAAGCTTTTAATACACTGGTGTGTATCCTGGAATGTGAAGCACAGGCGTCTCCGGCACTGACCTGGGATCTGTGTTACCAAGCAGCGGGTTTGAAGCATCTCCCACTGCCCTTGCAGGACGAGGAAACATCAAAGCGCTCGGATGATGAAGCGGAGCCTGTGGCTACAGTCAGCATAGAGAATGACAACGGTGTCGAATACACGGAGGCTTTAGAGCGCTTTCGACACGCTCTGCAGCCTTCAGAAGAGCTGGAGAAACTCACGGCTTCATATGACCCAGACCTCGACCCGCGGACACAGGAAGACCAGGATGATTTAGGAGACGAGAAGAGCGACGACGCAGCCGTAAGCGTGTCCAAACGATTCGGGGGCTTCATGAAAGGTCGTCACGGTTTACGTAAGCTGGTGAGCTCCGGAAGGCCTTTGCAGAAGCGCTACGGAGGCTTCATAGGGATCAGAAAGTCTGCCCGTAAGTGGAACAACCAGAAGCGCGTGAGTCAGCTCCTGCGCCAGTACCTGAGTTTAACGGGCCGGTCAGGTCGCTCGGGTCACATCAACAGCCTCTCCACCAGAATCCGGAGACAGAGCGAGGCGTAGGTGGCTGTTAACACAGGCCACGGTCACTTACCTCATCAGTAACTGTGAACATCTCCATCATGACATGCACCGCGACCCCAGAACTAACGTTAGATGTAAATCTGTGTTTAATCAAAGAAGAGGAATATTTTGTATAGCTGGGTTTTTAATCATTGACATTTCCATGGTGGCGACATCCCCCCCAAAAAAGCATCTGTTAGGACGAATGTTGCTGATGATGAGAACTGATTGTTCATTTATCTGAAACTCCGTCAATTAACCTTTGAAGCATTGTGAATACAAATAA
Gene targeted:
prepronociceptin
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Pituitary: (2)
Pigment: (9)
Kidney: (7)
Toxicity: (8)
Eye: (9)
Blood: (2)
Vasculature: (7)
- blood arrested
(21.43%, dose:2ng, p53:3ng, days: -)
- pigment cells colorless
(10%, dose:2ng, p53:3ng, days: -)
- eye small size
(10%, dose:2ng, p53:3ng, days: -)
- heart edematous
(35.71%, dose:2ng, p53:3ng, days: -)
- heart straight angle
(14.29%, dose:2ng, p53:3ng, days: -)
- common cardinal vein [proposed pooling]
(42.86%, dose:2ng, p53:3ng, days: -)
- head small size
(10%, dose:2ng, p53:3ng, days: -)
- tail coiled
(10%, dose:2ng, p53:3ng, days: -)
- blood arrested
(21.43%, dose:3ng, p53:4.5ng, days: -)
- eye absent
(40%, dose:3ng, p53:4.5ng, days: -)
- eye dysplastic
(40%, dose:3ng, p53:4.5ng, days: -)
- eye medial
(14.29%, dose:3ng, p53:4.5ng, days: -)
- eye small size
(37.5%, dose:3ng, p53:4.5ng, days: -)
- heart edematous
(29.03%, dose:3ng, p53:4.5ng, days: -)
- heart straight angle
(14.29%, dose:3ng, p53:4.5ng, days: -)
- immature otoliths count
(9.52%, dose:3ng, p53:4.5ng, days: -)
- common cardinal vein [proposed pooling]
(41.67%, dose:3ng, p53:4.5ng, days: -)
- iridophores absent
(40%, dose:3ng, p53:4.5ng, days: -)
- head small size
(29.41%, dose:3ng, p53:4.5ng, days: -)
- tail coiled
(35.71%, dose:3ng, p53:4.5ng, days: -)
- blood arrested
(35.71%, dose:4ng, p53:6ng, days: -)
- pigment cells [propose more pigmetation]
(100%, dose:4ng, p53:6ng, days: -)
- heart edematous
(28.57%, dose:4ng, p53:6ng, days: -)
- heart straight angle
(28.57%, dose:4ng, p53:6ng, days: -)
- immature otoliths count
(58.33%, dose:4ng, p53:6ng, days: -)
- common cardinal vein [proposed pooling]
(14.29%, dose:4ng, p53:6ng, days: -)
- blood arrested
(100%, dose:4.5ng, p53:6.75ng, days: -)
- intermediate cell mass of mesoderm [proposed pooling]
(100%, dose:4.5ng, p53:6.75ng, days: -)
- eye absent
(65%, dose:4.5ng, p53:6.75ng, days: -)
- eye dysplastic
(90%, dose:4.5ng, p53:6.75ng, days: -)
- eye small size
(65%, dose:4.5ng, p53:6.75ng, days: -)
- iridophores absent
(90%, dose:4.5ng, p53:6.75ng, days: -)
- head small size
(40%, dose:4.5ng, p53:6.75ng, days: -)
- tail coiled
(40%, dose:4.5ng, p53:6.75ng, days: -)
- eye absent
(70%, dose:6ng, p53:9ng, days: -)
- eye dysplastic
(70%, dose:6ng, p53:9ng, days: -)
- eye small size
(70%, dose:6ng, p53:9ng, days: -)
- iridophores absent
(70%, dose:6ng, p53:9ng, days: -)
- head small size
(70%, dose:6ng, p53:9ng, days: -)

Images