MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2012B    
Morpholino sequence: GCTCAGCATTTAGCACTCTTGCATT
Find in ZFIN Find in Genbank
Target name: spry4
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TAGAAGACTGTGTCCTTACTGCAGTGCACATCGCACGGATAGACGTCCGCTTTTACTCCGCGGCTTCGT TTGGATCTATCTGTCTCTCTTTTTGCCACTGGAATATATCGCAACGACCTGTTCATCTGAGAAGGAAATG ATCTGCTTTCGAATGCAAGAGTGCTAAATGCTGAGCTCTGGTATATGAGGAACACGACCTACAGATGGAG TCAAGGGTTCCTCACCACATTCCCGGCGTCTCCTCCTCCATCATGGTGCAGCCGTTACTGGACAGCCGCG TTCCCTACGGACGCCTCCAGCACCCGCTGACCGTCTACCCCATAGACCAAATGAAAGCTTTGCATTTGGA GAACGACTACATCGACACCCCTGCTGTGATTTCACAACAGCCACCGAGCCACAAGGCAAACCCCAGGGGC CAGGAGGTCCTGCTGGGAGCCCCACACCATCCGAATTTATCCCGCTGTGAGGTGCCAGATGCCACCACGC ACCCCTGGATCTCCTTCAGCGGTCGGCCTAGCTCCATCAGCAGCAGCAGTAGCACGTCTTCAGATCAGCG GCTGCTGGATCACGCAGCTCCTACTCCTGTTGTGGATCCGTATACGACCGGGAATTCCCACGGCAGGACT CTAGCTGCGGAGCAGCCCAAGATACTGAGCTCCAAGAACATTAAGACACTGGCAGCCTTGCCTGAAGAGA AGAAAAAGCATGTGCTGCTGTGCGAGAAATGCGGGAAATGCCGATGCACCGAATGCACGCTGCCCCGAAC CTTGCCTTCTTGTTGGGTTTGCAACCAAGAGTGTCTGTGCTCCGCACAAAACCTAGTGGACTCGGTGACT TGCATGTGTCTAGTCAAGGGGGTTTTCTACCACTGCACTGATGAGGACGAGGAAGGCTCCTGCGCGGACA AACCATGCTCCTGTTCGCACTCGAACTGTTGCGCACGCTGGTCCTTCATGGCAGCCGTCTCATTGGTTTT GCCCTGCCTGGTGTGCTATTTACCTGCCACTGGCTGTGCCAAGCTTTCGCAGAAATGCTACGACGGCGTC AGCCGCCCAGGATGCCGATGCAAAAGCACCCAATCCTGCAAGGTGGCAGAAATCAAGGCCTGTCAGCCAG AAAAACAAGCCTCATGATGGTTTGCAGGACCTTCCTCCCAAAATCATGGTACTTAAGGTGTTGAAATCAG TAGCAATGTTTGACTGAAGGGCACAAATGGTCATTTCACGTACTGCAAAGAAGTTCTTTTCCTCACGATG GTTCTACGTATTAGCCTCTACTAAACCTTGCAAACACAGAATGCTGCATTTCCAAAAGATCTCTGTTTGT TTTCTCTTTGAGAAACCACCCATTCAGAAGCGTTCTCCACTTTGGCAATCCCTCTCCGGATCCGGAAGAC AGAAAGTGCAGCGAATTCCAAGCTGATAACACATGTCACAATCAAAATAACCAGACTTCATCTCTGTGCA CAGTGCATTTACGAGCTTGTTCTAGAGCTTTTATTTCTTGTGTTGTTTGAAATGCAAACATGGGAGGTGA TTGTGTGCCACTGAAGGATTCCGAGTCCCCATTGCGAAAGACGCCAGGTATCCTCGTGGCAGGATGTTTT CAATCTTCAGTGGGGGACCGAATGTTGGTTTGTTTTTTTGATGGCTAATAGGTGAAAAAGCTTTCGTGAG TCCCTTTGATGACATGCCATAGCATACTTCCATAAAGATTCTTCCAAATGTTTAGCGGTTCAGTTCGTTG TATGACCTCAGGGATCATCAGTTTATCTGAAATTACATGTGAATTCAGCTTGGAAGGAGTTTGGTGACTA TATAGCAAGGACATTCATAAGCTACGAGAGGAGCTGCGCCAGCAGTGAGACTAGCTATAAAGCTAGCTTA ATAAACACGCCAATCACCATGATGACGAGGCAAAAGCACAGTATTATGTACAGTAGATGTACAAAGTGTT TCACTGTAGATGAAAGACAAACAAAAAACTCTCTAGTTTACTACCGCTACCAAACATAACACGCGCCCTA GTATCAAACTGCTCTATTTTTGTCGTCATGTGTATAGAGATGGTGCCAAAGGAGTGCACCGTGGGGTTTT TGGTTAACTCGAGTGGGCGTGCGTTGTTGTACTCTAGCCAATTAGTAAGCTCTTAAAGGTACGGTGCACA CTTCACCAAGATCCCTAGAGGGCACGAAGGGAACGAATAACGCCTGCCTTTTTTTTAACCCGCGAAACTA GGACCTCGCTGGTCTGTATTTTCTCATATTCCAACATTTGCACAAATCCGAAAAGCAGAAATACACTACT GTTCTTAGTCTTGAATGTATAAGGCTAGGGTATACGTTTGCAATCGAACCCGCCGTGGATAGCGTACGCA TATAGCCGCATTGGGAAGAGTTGCAAATGTACCATAGATTATTTGTTTCGTTGTTGACCTATGCAGGTTA CTTGTAAATAGTCATCCAAAAAAAAAAAAAAAAA
Gene targeted:
sprouty (Drosophila) homolog 4
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
sprouty4, zSpry4
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Vasculature: (13)
Morphology: (3)
Blood: (6)
Eye: (1)
- blood decreased
(40%, dose:4.5ng, p53:ng, days: 30 hours)
- cardiovascular system [propose decreased flow]
(40%, dose:4.5ng, p53:ng, days: 30 hours)
- common cardinal vein [proposed pooling]
(40%, dose:4.5ng, p53:ng, days: 30 hours)

Images