MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2061    
Morpholino sequence: GGCACCCGACATGCTGAGAGATTTG
Find in ZFIN Find in Genbank
Target name: pacsin1
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TGCAGGATCGTCATATCACAGAGAAGCTGGATTCACGTTCATCTCTGTTTGTGCATGGTGAATTTGGTT TGTTAGCTTCAGTCGTGCTCAGCCAAATCTCTCAGCATGTCGGGTGCCTACGATGAGTCCGCCATGTCCG ACGAGACCACAGACAGCTTCTGGGAGGTTGGAAACTACAAGCGCACAGTGAAGCGCATTGAGGACGGTCA TCGGCTCTGCAATGACATGATGAGCTGCATACAGGAGCGGGCAAAGATCGAGAAAGCTTATAGCCAGCAG CTCACCGACTGGTCCAAGAGATGGAGGCAGCTCGTGGAGAGAGGGCCGCAATACGGTACACTGGAGAGAG CCTGGTTAGCTGTGATGACCGAAGCTGAAAAAGTGAGCGAATTGCACCAGGAGGTGAAGAATAATCTGCT GAATGAGGACTTGGAGAAGGTGAAGAACTGGCAGAAAGACGCCTACCACAAACAAATGATGGGCGGCTTC AAAGAAACCAAAGAAGCGGACGAGGGCTTTCGGAAAGCGCAGAAGCCTTGGGCCAAAAAACTCAAAGAGT TGGAAACAGCAAAGAAAACCTACCATATGGCCTGTAAGGAAGAAAAAATTGCATCTGCAAGGGAGGCCAA CAGCAAAGGAGAAGCGTCTGTCACAACAGATCAGCAGAAGAAACTGCAGGAGAAGGTGGACAAGTGCAAA AACGACGTCCAGAAGGCCAAAGAGAAATACGAGAAGAGCCTGGACGAGCTGAACAAATGCACACCGCAGT ACATGGAGAACATGGAGGTGGTGTTCGATCAGTGCCAGCAGTTTGAGGAGAAGAGGCTGAACTTCCTCCG TGAGGTGCTTCTGGATACCAAACGCCATCTCAACCTCACCGAGAGCCAAAGCTATGCCACAGTGTACCGG GAGCTGGAGCGCACCATCGTCTCGGCCAGTGCTCAGGAAGACCTCAAGTGGTTCAGTAGCGTCCACGGGC CCGGCATGCACATGAACTGGCCACAGTTTGAGGAGTTCAACCCAGACCTGAGCCACGCCATCAGTAAGAA GGAGAAGGTGAAGAGGAACCATGATGGAGTCACACTGACTCAGGTCACACACGGTGCGGAGCACGGCACA CCGCAGACTGGAGACCGGGGCAGTGTGAGCAGTTATGAGAAGAACCAGCAATATTCTGCAGAATGGTCTG ATGATGAACAGCCGCCCACTGCCGCACAATCAGCCAGTGAAACCAACGGTGGAAATCCATTTGAAGAGGA CAGTAAAGGAGTGCGAGTGAGGGCGCTGTATGACTACGAGGGCCAAGAACAAGACGAGCTCACATTTAAA GCAGGCGACGAGCTGACCAAGCTGGAGGATGAGGATGAGCAGGGCTGGTGTAAAGGCCGTCTGGACAGCG GTCAGCTCGGCTTATACCCAGCAAACTATGTGGAACCTGTTTAGTTGTCTTATTTCCCGAAGAAGGCCTT AAAGACTTTTACCCCAACACTGTTCCAGTGCAAGATTCTGGAGCAACTCTTTCCTTGCCTGACTGACTTG CTGAGAAGCTTTATTACGCAGCATTTCCTTAATACCATAATGAGAAAAAACACATATCGAGCAGGGAATG ATGTGTAGCCATGTTCAGTATGATTTATTGTGCTGCTGACATGTGTTCGCGTAACAATATTACTGTATTG ACGTCCACAAAGCCAAGCATAGCAAGAATCAGCTATGCAATGTGTACACAAAGACTTTTATTTTGAAATG TGGTAAACCTAACACTGATAAAACTGGAGTTTGGTGATGAGATTGGGGCTTGTTTTATGCTAATTGGATT GCGAAAAGTGGGCGGTGCTAGATTGTCTGAACGTTATTGGATGGGAGGAGTTTGAAAGTTAAAGGGCTTG GGGACTACATTTAACAAGGGCAGTCGTTGTAGAGCATTGTTATTTTTGGACGTATTTTTTCTTGAAGAAT TTTGCAAATACCAGAAAATGTGTTGAAGGAAATGATGTCAGATTTGATTTCATTCATTCAGATTATTATT TTTTTCATCAAAGTGCAAATTGATGCCTCAAAACACATTCATTGTTACTCATTTGAGATGTTAAAGCCTG TGAACAAAATGTAAAAGACTAGAATTTTAGTGTCCATGATTATTATTTTTTTAATATATGCTGTTTTTGA TGGAGTTTCTGTCATAATTTGGTATTTAAATCCGAAAAGAAGAGATAATTAGTTTATTTAGTGCATTTTT GGATTAAATTATGATTCTTTTTTCATTCATTTCTTATGTTTTCATGACCATTGAACTGTCTTCACAGTGA ACTCTGAACTTTTCCAAAAGCTCTTGGGTCTTTATTCTGCCTTTCTGCCTGTTTAAGAAAATGGGAATGC CTTTTAACATGCGATCCATAGCAGTGCAACGGTACTACTAATAACCTCCCGTCGTTTCTTTCGCCATGTA TTTTAAGACTGAAGCTTTGTTTTTGGCCTTCTGTGTCTTTAAGAGCAGGATCGAGGAGCTGTATATACTG TATACTGTATGTTTAGACTGGACTGATGTGCTCTTGTCAGTGTAGTAACTGTTCCATTCAAGTTCACAAT AAAAACTCATAAAGCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Gene targeted:
protein kinase C and casein kinase substrate in ne
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Vasculature: (8)
Morphology: (9)
Blood: (12)
Eye: (4)
- eye absent
(20%, dose:3ng, p53:ng, days: Day: 3)
- eye dysplastic
(30%, dose:3ng, p53:ng, days: Day: 3)
- eye absent
(100%, dose:4.5ng, p53:ng, days: Day: 3)
- eye dysplastic
(90%, dose:4.5ng, p53:ng, days: Day: 3)
- blood [proposed pooling]
(100%, dose:6ng, p53:ng, days: 30 hours)
- blood decreased
(100%, dose:6ng, p53:ng, days: 30 hours)
- blood decreased
(70%, dose:6ng, p53:ng, days: 48 hours)
- cardiovascular system [propose absent flow]
(85.71%, dose:6ng, p53:ng, days: -)
- eye absent
(77.78%, dose:6ng, p53:ng, days: Day: 3)
- eye dysplastic
(72.22%, dose:6ng, p53:ng, days: Day: 3)
- eye small size
(77.78%, dose:6ng, p53:ng, days: Day: 3)
- heart slow rate
(85.71%, dose:6ng, p53:ng, days: -)
- somite square
(85.71%, dose:6ng, p53:ng, days: -)
- head count
(20%, dose:6ng, p53:ng, days: Day: 3)
- blood decreased
(90%, dose:7.5ng, p53:ng, days: 30 hours)
- blood decreased
(25%, dose:7.5ng, p53:ng, days: 48 hours)
- common cardinal vein [proposed pooling]
(90%, dose:7.5ng, p53:ng, days: 30 hours)

Images