MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2062    
Morpholino sequence: ATCTTGAGTTTCAGCCTTCTGTCCG
Find in ZFIN Find in Genbank
Target name: sparc
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
AAAGTTCTCTCAGAAAGTTTCACCAGCTGACTTCTCCTCTGGCTTCTCTGTAAGACGGACAGAAGGCTG AAACTCAAGATGAGGGTTTGGATCTTCTTCCTGTTCTGCCTCGCTGGCAAGACTCTGGCAGCTCCAACTG AAGAGGAGCCAGCTGTTGAAGAGGAGCTGGAAGTGGGAATAAACCCAGTCCAGGTGGAGACCGGAGAGTT TGATGAAGCCATTGAGGTCGTGGAGGATGTTATTGCTGAGAACCCCTGCCTAAACCATCACTGCAAGAAG GGCAAAGTGTGTGAGGTAGATGACAGCAACCAGCCCATGTGTGTGTGCCAGGACCCTTTGACCTGCCCCG CTCCAATCGGAGACTTCGAGCATGTCTGCGGCACTAACAACAAGACCTACGAGTCCTCCTGCCACTTCTT TGCCACCAAATGCTCTCTGGAGGGCACCAAGAAGGGCCACAAGCTGCACATGGATTACATCGGACCCTGC AAATACATCGCTCCCTGCTTGGAGAATGAGCTGAATGAGTTCCCCCTGCGCATGAGAGACTGGCTGAAGA ACGTGCTGGTGACTTTGTATGAGCGTGATGAGGACAACAACCTGCTCACCGAGAAGCAGAAACTCAGGGT GAAGAAGATTTACGAGAATGAGAAGAGGCTTCAGGCTGGTGATCACTCTCTGGACCTTTTGGCCCTGGAC TTTGAAAAGAACTACAACATGTACATCTTCCCCGTTCACTGGCAGTTTGGCCAGCTTGACCAGCACCCTA TTGATGGGTTCCTGTCCCACACTGAGCTGGCCCCTCTGCGTGCTCCTCTTATCCCAATGGAGCACTGCAC CACCAGCTTCTTTGAGCAGTGCGATGCTGACCAAGACAAGTACATCGCTCTGGAGGAGTGGGCAAACTGC TTCGGGATCAAAGAGCAGGATGTCGACAAAGACCTTGTCATCTAAGGACGTCTTCCATTGATGCTTCCTA GTTATTATTGGGGGGAGGTGCTAACCCTTAAGTTAAAATCAAAGTAAAGGTGCTAATTGCGATTTCTAAC AAGCTGCATATACCACTAAACATTCAAAATGTTTAAAAAAGTGCACAGTTCACACTGTAGCTATATCACA ACAAGTGATTAAATACTGGCCAATTTTTTACGTTAGCTGATGTCAGCCAAACAAGAGAGTTAAATATTAT GAACCATGTATATTGCAAGATACACTTTTTGTTTTGGATCTACAATTTCTTTTAAAAACTCAGATTCAGG GCTTGAATTGTAAGTTTGGATGGTGGAGATGTACAAAAAAAAAAAAATAATAAAGTTTCCAAATAAA
Gene targeted:
secreted acidic cysteine rich glycoprotein
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Vasculature: (9)
Morphology: (8)
Blood: (14)
Eye: (4)
- blood decreased
(75%, dose:6ng, p53:ng, days: 30 hours)
- tail [proposed pooling]
(70%, dose:6ng, p53:ng, days: 30 hours)
- blood decreased
(60%, dose:7.5ng, p53:ng, days: 30 hours)
- blood decreased
(80%, dose:9ng, p53:ng, days: 30 hours)
- cardiovascular system [propose absent flow]
(100%, dose:9ng, p53:ng, days: -)
- heart slow rate
(100%, dose:9ng, p53:ng, days: -)
- somite square
(100%, dose:9ng, p53:ng, days: -)
- tail [proposed pooling]
(80%, dose:9ng, p53:ng, days: 30 hours)

Images