MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2064    
Morpholino sequence: TACGCCGACCTTGTATATTTACTGA
Find in Genbank
Target name: bmi1b
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GCCGCTTCTGTAGCATTCATTTTTTGCTGATCGACTCTCAAGTTTCATTGTCTACCACAACAAAGCTCC GAAACCATCAGTAAATATACAAGGTCGGCGTACTCCCATGACAATGCACCGGACAACGAGAATCAAGATA ACGGAGCTAAATCCTCATTTGATGTGTGTTTTATGTGGAGGATACTTCATTGATGCGACCACTATTGTTG AATGTTTGCATTCGTTCTGCAAAATGTGTATTGTCCGGTATTTGGAGACCAGCAAATATTGTCCTATTTG TGATGTCCAAGTTCATAAAACAAAACCCCTCCTCAACATCAGGTCAGATAAGACCCTTCAGGACATTGTT TACAAGCTGGTGCCTGGTTTGTTTAAAAATGAGATGAAAAGGAGAAGGGATTTTTATGCTGAACATCCCG TTGATGCTACTAATGGTTCCAATGAGGACAGAGGAGAGGTGTCAGATGAAGACAAGAGAATCATTGCTGA TGATGAGATCATCAGTCTGTCCATTGAGTTTTTTGATCAGAAAAAGCTTGATGGTAAAGATGGGGAAGAA AAAGAATCCACAAAAGAGGTGACTGTAAAGCGTTACTTACAATGCCCTGCAGCTATGACAGTAATGCATC TCAGAAAATTTCTCAGAAGTAAAATGGATATACCATGTACCTTTCAGATTGAAGTTATGTATGAAGATGA GCCTTTGAAAGATTATTACACTCTTATGGATATTGCTTATATCTACACATGGAGAAGGAATGGGCCATTG CCTTTGAAGTACAGAGTTCGACCGGGCTGCAAAAAAATCAAGTTGAGCAGTCCCAGGAATGATATGAGTG GTGGCAGAAGGCCTGATACGGAAAGTGATTCCAGCAGTGACAAACCAAACAGCCCGAGTATTGTTGCTGC CCCGTCTACATCATCCTCTATGCCCAGCCCAAACACCCCTGTCCAGTCTACACACCCCAGCTTCCCTCAC ATCTCCACCATTAATGGAGTCTCTGCCAAAGTGGGCCACAATGGCCAAACACCTTTCAGCAGCAAAGTCT GCAAAACTTCTCATAATGGCTCTAACTCTCTTGGGTGATTTGCTCATGGATGCCAAAGCCATCGATGCCA TGAAAACAGAGCTGTGATGTATATGCTTTCTTTATAAACCACCTCTTTTTGTATCATTTTTAAATATATT TGTTTTGTCACCACGTGTGAGGACTGGTAACACAGCATTGTTTGTGTTATATTTTGTATTGAATAACTAA TATTGTGAAGAGTACAGGATGAGAACTCGAAAAGAAGGAGAATGTATCTAGATGTTTTTATAAACTCTGT CTTGTTCATTTAGATTAGAGTGCCAGTGTATATAAATCATTTATTTTTTTCCATGACTTCTCCGTTGAAT TAGCGGCACAACCAATGTTTTGTTTATATTCAGATTTTCTTTCCAGGCGAAAAGTGTAAAACCAAAACTA CATTTGCAAAAGGGCAACAATGCAGCGTCAGTATTGTTTCGGATAAACTCAAATTGTAATAATAATGGAA AAAAAATCTGCTATGTACGTGCTCCTCACATAAGTTGAGAAATGTTTTCATTTTCTCGGTGTTATGGCGC GGGGATTTAAAGTAGGCTAAATAGCCTTATAAATAGCCTTAAGTTCAGTTTTCTGTCTTGTTCTACATTT CTGTCCAAACGGTTAAAACCAATGTATAATTTACTGTTGTACAATATGAAACCTTTGTCTAAATAAACAT TTTACTTTTTTATTACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAA
Gene targeted:
B lymphoma Mo-MLV insertion region 1b
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
pcgf4b
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Vasculature: (8)
Blood: (8)
Eye: (1)
- blood decreased
(50%, dose:6ng, p53:ng, days: 30 hours)

Images