MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2066A    
Morpholino sequence: ACGTCATGTTCAGGAGATATTTCGC
Find in ZFIN Find in Genbank
Target name: snx5
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GAGGAACGAGCTTGCTGCTGGAAAGTTAAAAGTGCAGTTTAATGTACAACCCAGAGCCGATAAAATAAG CGAAATATCTCCTGAACATGACGTCTATTTCAGAGGACAGCGATAAGGAGAAGGCACGTTCTGTATCTGT TGACTTGAACAATGATGCATCTCTCCTCATTGATATTCCTGATGCCCTCTGTGAAAGGGACAAAGTCAAA TTCACCGTCCACACCAAGACCACACTTAGTTCCTTTCAGAAGCCGGACTTTTCTGTGCCACGACAGCATG AAGATTTCATCTGGCTCCATGATGCAATTGTGGAGACTGAGGAATATGCTGGCCTCATTATCCCTCCTGC CCCACCAAAACCTGACTTTGAGGGTCCCCGAGAGAAGATGCATAAGCTGGGAGAAGGGGAGTCAAGCATG ACAAAGGAGGAATATGCCAAAATGAAGCAGGAACTTGAGGCGGAATATCTTGCTGTTTTTAAGAAGACTG TGCAGGTTCATGAAGTGTTTCTTCAGCGACTTTCCTCCCATCCCAGCTTCAGCAAGGATAGAAACTTCCA CATATTCCTGGAATATGACCAGGATCTCAGCGTGAGGCGGAAAAATGCCAAGGAAATGTTTGGTGGTTTC TTTAAGAACATGGTGAAGACCGCTGATGAGGTCCTCATCTCAGGGGTCAAGGAGGTTGATGAGTTTTTTG AACAGGAGAAGACTTTTCTGTTGGATTATTCTAATAAAATCAAAGATTCCACGGCTAAGGCTGAGAAAAT GACCCGTGCACACAAAAATGTTGCTGATGATTATAACCACATTTCCGGGGCTCTGAACAGTGTTGCAGCT GACAACAACTCTGCCTTTAAAAAGCACTTGGAAAAATGTGTTGAAGTATTTGAAAAGCTTAGAAAAGTCG AGGACAGGGTGGCATCAGATCAGGAGCTCAAGCTGACAGAATTGTTGAGATACTACACAAGAGACATCCA AGCTGCTAAGGACCTGTTGTATAGACGTGCACGGGCACTTGCAGATTACGAGAATTCCAATAAAGCTCTC GACAAGGCACGTCTAAAAGGCAAAGATGTCCCACAGGCTGAGGAGAACCAGAAGCAGTGTCTTCAGAAGT TTGATAGGCTTTCAGAATCTGGCAAGAAAGAGCTCACCAGCTTCAAGGCAAGACGTGTAGTAGCCTTTCG TAAGAACCTGATCGAGATGACTGAGCTGGAAATAAAACATGCCAAGAACAGCATGTCCACTCTGCAGGGC AGCATTGAGCTGCTGAAAAGCAACTGACCCACACGATGATGATGTCGCTGCACCATCATGAGCTCCTAGC ATTGTTACCAGCCCATTAGAGTGTAACCTAAATGCACCTACTTCAGTTATCCCTAACGTGGTTCACTAAC CACTTTAAAACATGAAAAAGAGCAACCGCAGTGTTTACACTTTGCCTCGTTTTTTCCCGCTTATGTTCTT TTTCACTGCCAGTACCATCTCATGAAATTAATGCAGTGATAACAACCTGAAAGCTCTCTAATATGTTCAC TTATGAGTTGTTAAATCCCTGCATTAGCCGTCGTTTTTTACATATTCCAAGTTATGCAAATATTAGCTGA TATATCCTATCTGAGATTATGCAGACACGTAAAGTACCACTATGACAACAAGTGGATCATTTCAGTGATT TTTCTGTTGTTTTGACTGCAGTTTTGTACCTTTAAATGTGATTAATCTGCCTTTTTTCTGGCACACTGGA AAGCTGATGCGTACTAATCATAAACTATTAAACAAAACTTGACCTGTGATGAGAAACAGAGCAGTATATC AGAAGTGTTATGTGAAATGAAATGCTTCTGATATCTTTCCTCCTAATATTTTTTTGTTGATTTGAGATTC GTCCGAATGCATTACTCTCCATCACAGATTGCTGCACACAAATGTATGTTTCAAGAGAATGCTGACGTTA ATTTACGATCACATTTTTTGCCAAATTACACTTCCTTTTACTTTAAATGAAAAGGACTGACTGATGTCCT CAGTTG
Gene targeted:
snx5
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Vasculature: (12)
Morphology: (10)
Blood: (14)
Eye: (6)
- blood decreased
(100%, dose:4ng, p53:ng, days: 30 hours)
- blood decreased
(70%, dose:4ng, p53:ng, days: 48 hours)
- cardiovascular system [propose absent flow]
(57.14%, dose:4ng, p53:ng, days: -)
- eye absent
(85.71%, dose:4ng, p53:ng, days: Day: 3)
- eye dysplastic
(14.29%, dose:4ng, p53:ng, days: Day: 3)
- eye small size
(85.71%, dose:4ng, p53:ng, days: Day: 3)
- heart slow rate
(85.71%, dose:4ng, p53:ng, days: -)
- somite square
(57.14%, dose:4ng, p53:ng, days: -)
- tail [proposed pooling]
(100%, dose:4ng, p53:ng, days: 30 hours)
- eye small size
(50%, dose:4.5ng, p53:ng, days: Day: 3)
- blood decreased
(70%, dose:5ng, p53:ng, days: 30 hours)
- blood decreased
(80%, dose:5ng, p53:ng, days: 48 hours)
- cardiovascular system [propose absent flow]
(33.33%, dose:5ng, p53:ng, days: -)
- eye absent
(87.5%, dose:5ng, p53:ng, days: Day: 3)
- eye dysplastic
(62.5%, dose:5ng, p53:ng, days: Day: 3)
- eye small size
(87.5%, dose:5ng, p53:ng, days: Day: 3)
- heart straight angle
(57.14%, dose:5ng, p53:ng, days: -)
- somite square
(33.33%, dose:5ng, p53:ng, days: -)
- blood decreased
(65%, dose:6ng, p53:ng, days: 30 hours)
- blood decreased
(65%, dose:6ng, p53:ng, days: 48 hours)
- cardiovascular system [propose absent flow]
(92.86%, dose:6ng, p53:ng, days: -)
- eye absent
(75%, dose:6ng, p53:ng, days: Day: 3)
- eye dysplastic
(81.25%, dose:6ng, p53:ng, days: Day: 3)
- eye small size
(75%, dose:6ng, p53:ng, days: Day: 3)
- heart slow rate
(100%, dose:6ng, p53:ng, days: -)
- heart straight angle
(100%, dose:6ng, p53:ng, days: -)
- somite square
(92.86%, dose:6ng, p53:ng, days: -)
- head count
(10%, dose:6ng, p53:ng, days: Day: 3)
- tail [proposed pooling]
(80%, dose:6ng, p53:ng, days: 30 hours)

Images