MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2067    
Morpholino sequence: AAGCGACTCTCTCACCCTCGGCTTG
Find in Genbank
Target name: nfat5
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GCTGATCAGATGGAGAAAAAGCACACGAAAAGCCTCCCGAGTGTGAAGCTGACCACACTACACGTGCTG TAAAGCCTCCATGAGGATTTTATGACAGAGTTCATCTCTCTTTCTGTGCGCTCTGCTCTTCAAGCCGAGG GTGAGAGAGTCGCTTCCTCTGAGCTCATGAGGCTTTAGCATGCTAGCATGCCCTCTGATTTTATATCTCT CCTGAGCGCCGATATCGACCCCAGTTCTCCCAAATCTCTCTATTCCAAAGAGTCTGTGTATGACCTGCTG CCTGCAGAGCTGCAGCTGCCGTCGCTCGTCCAGCAGGAAAACTCCAGCATGAGCCAGAAGAGCGGTGGAG AAGCCGGACCTCCTCCTGCTGCTGCTGCTGCTGCACTGCCCACAGATGCCGCTGCCCCGTGCGCCGCTGC CTCCTCCCCAGGGGCCCTCAGCAGTACGCTTCCCTCCTGTCCCAGCATGCTCTCTGCTACCTCAGCCCCG GAGCAGACGCCGGAGCCACAGCCGGAGCGTATGGAACCTGCATCAGATGCCGCACAGAGCCAGGCCACCC CCTCCAAACGCCGCACCGTCCTGAGCATCTCGCCGCCGCCGGAGGACCTGTTGGACGACAGCCGGATGTC CTGCCAGGATGACACGCTCCCGAATCTGGACTCGGAGCAGAGCAGCACCATCTGGCTGGAGGACTCCGTG TCCAACTTCAGCATGGGCAGCAGCAGCTCCTACAACGACAACACGGAGGTGCCCAGAAAGTCCCGCAAGA GGACGCCCCGCCAGCGACCCGGCTCCAAACCCGCGGCCCGAGAGGAGGCTGGCATGGATGTGTTTGACGC CGACAGCGCTAAAGCTCCACACTTTGTACTCTCACAGCTGGGTTCAGACGCCAAAGTCACACCTAAAGCC AGCTCCCTGGAAGTGTCAAATAACCAGAAAGGAGGAGTTTTGTCCATTCAGTACCCTCCGAAGAGCGAAG GGAAGGAGCTGAAGATTCTGGTCCAGCCGGAGACGCAGCACAGAGCGCGATACCTCACAGAGGGAAGCAG AGGATCCGTCAAAGACCGCACGCAACAGGGATTCCCTACAATCAAACTAGATGGCGTCAGTGACCCAGTG GTGCTCCAAGTGTTTGTGGCCAATGACGCTGGACGTGTGAAGCCGCATGGGTTTTACCAAGCCTGCAGAG TGACCGGACGCAACACCACGGCCTGTAAGGAGGTGGACATCGAGGGGACCACAGTAATTGAAGTAAACCT CGAGCCAACCAACTCTATGACCCTACCCGTGGACTGTGTTGGCATCTTGAAGCTGAGGAATGCAGATGTT GAAGCTCGTATTGGAGTTGCAGGATCCAAAAAGAAGAGCACTCGCGCACGTCTGGCCTTCAGAGTCAACA TCCCAAGACCTGATGGATCTATCCTGACCCTCCAGACTCTCTCCTCTCCGATATTATGTACTCAGCCAGC TGGAGTGCCTGAAATCCTTAAGAAGAGTCTTCACAGTGGTTCTGTAGCAGGAGGAGAGGAGGTCTTCATA ATCGGCAAGAACTTTCTCAAAGGAACCAAAGTTCTTTTTCAGGAAAATTCATCAGATGAGAGTGGCTGGC AGGCTGAAGCAGAAATCGACATGGAACTTTTCCATCAGAATCATCTAGTGGTGAAGGTTCCCCCATATCA TGACCAGACTGTGGCCAACCCGGTGTCTGTAGGGATCGCTGTTGTGACAAACGCAGGAAGAACGCATGAT TTACAGACTTTTACTTACACTCCTCTAACAGAGAAAGTTGAAATACCGGTGAAGTCAGAACTGCCCGCCA CAGTCAAGGCTTGTACCTTTGAAGAGCAGATCAAAGCGATGCAAACTGAAACCAGCTGTCTAAATAATGT TATAATGTTACCGATGGTCAAGCGCGAAGAGCCTATGGAAGTCTCCTGCAATGCTACTCCTTCTGACATT TTTAAGCCTGTAGAGACTCTTAGTTCAACCCAGCAGATATTGGAGATCAGTACTGTCCTTCCGTCTGCCA CCAAATCTTTTCCAAGCCCAGTGGCTCTCCAACCCGTCGACTCCCAGCAAGCTCCGGCTCAAATCTTCAC AACTCAAGAAACATTGGCCACCATTCAGAAGCAGGACATTCCTTCACCTGCCTCCTTTCAAGTGTCCTTG TCAGAGGACACAACCGTTCTCCAGCCGGTTCCCCCTCAGGTCCCGCAGCAGTCCTTGCGGGAAACCCCAG AAACACTGTCTCCAGAAGACAGCAGTGCAGATGGTGCTGGAATGGTACTGGTGGGCATAGACAGGAATCC GCCATCCCAGCGCCAACAGGTCCAGGCTCTTCTACCTCAGGATGGGGTTGCACAGCTGGAGCTGGCAGTG AGAGAGCTGCAGGCACAACAGCAGCTCAATTCTGTACTTTACAGCCCGACTCCGTCTGCAGAAAGCCTTC AGCAGCATGTGCAGGAAAACATGAACAGCCTACGGTTAGGTGGAAATGAGACGACTCTAACCAACCAGCA ACAGCAGCAGCAAGAGCAGAATATACTGGAGAATCTGCAACAGCAGCAGCAGAAGGCTCTCGTGGATCTA CAGCATCAACAAACTGTCCTGGAAAATCTTCAGCAACATCAGAAAGTCTTGGAGAACCTCCAGCAACATG CTATGGGCAACATCCAGCAGCAACAAACACACAAAGTCCTGGAGAATCTGCAGCATCAGCAACAGCACCA GAGAGTTCTGGAGAACATTCAGCAGCAAAGTTCAATTGTGACTCTGCAGCATCAGAAGGTTCTGGACAAT CTCCAGCAGCAGCAACAGCATCAGATTAATCTAGAAACTCTTCAGCATCAGGAGGTGTTGGAGAGCCTGA AGCAGCAGCTACAATCAGAGCTCATGCAGACGCAGATACCAATGCAGTGCACGCCTAGCTTCACTAACGA TCAGCAAAGCTCCACACAGGCTAGCACCCTCCCGCAGTCCTCTGACGGATTTCTCCAGAACCCCCCGCAG CAGCAGGCCGCACTTTTCCAGCAGACCGGTGGGATCATGACCATACAGACCTCTGGCTTTCTGCAGCAGC CGTCTGCTCAGCCATCGCCTCCTCAGCCGCTTTTCCAGAGCCACAACCCCTTGACGGAAACTCAAGACAC TCAGGCTGTACTCTTCGGAGCCACAAAGCCGCCACAGGTCCAAGCAGCCTTATTTCCCAGTACCATGACA ATGCTAACAAGCAGCAATCTCCCCACAGAGCAGCAACCTCCTTCAGCTAGTCTGTTTATCGCGCAGAGTG TGTTACCAGCATCAGATAACACCCAGAACCAGCCGCCGCAGCAGATCACCTTCCTCACGCCCATGCAGAC CTCAGGAGCCGAACCCCAGACAGTCTCACTTTTTCAAGGACAGACGCAATTGTCCACCCCAATGGAGCAA CAGCAGTCTCCTCAACAGCAGCAGATGCCAACCTCTCAACAAGCCCCTCTATTCTCGAATATCACCACAA TATCCCCAAATCAAGCACAGCAACCAACTCAGACGGGAATACTGTTCTGTACAACAACAATCAATCCTCA CGATCTCCCCCAGGCTCTGCTGTTCAGTGGCCAGAATCAGGCTTCGCTAGGAACCGATCGGCTCCCAGAG AATATCTTTCAGGAGCAGCAGCCCATGCAAGTGGTTCCCAGCTCTGAAAATGTTTCTTCCAACAATCCTT CGAACCAGCCCGCAGTCCCAGCAGCGCAGGCCGCTCAGAACCCATCAATTATTTTCACACAAACCGGTGT GGTGAATGTTGCTCAGCAAGACTCTGCAGAACCCATGTCTTTTCAGGACCAGAGCACCGGTGTCAATGAA TCCTCTGCCAGTTTGCCTTCAACACGGACAGAACTGTTTCAGGACCAGCAGCCCATGCAGGTTGTGCCCA GTGCCGCAAGCGTAACCCCCGTCTCTCCTTCGGACCAACCTTCTGTCAACATTTACTTGCCTCCGTCAGC AATTTCGGCCTTGCAGGGTGGTGTAAGTGCTCAGGATTTACCTCCAGCTGCCGCAGCCGCCACCATGTTT AGTGGGCAGACTGGTGTGTCAGGACTGCAAAACGCCGCCCCGACTGCCCCTCCACAGCCATCCAGCCAAC TCTTCCAGACTGCTATTGGGGGAACCCTAAGCCAGCCGGGACCGCCAGGACCAGCTGGCCTGTTTCTCTT TGAGATTCCCAGTGATTGTGGAACGTTAATAAACTCTCCCGGTCCGCCGTTGTCCGATCAGCTGGTCACT TTGGGTCATCCCGGTGCGGATCAGAATCAGACCCAACTTCAGACTAATGCACAGATTCAGACCTTACTGG ATCCGTCTAGCAACCTGGAGGACAAGATAGACCAACTTCTGGAGAGTTTTCAGGAGCAGGGAAAGTCGCT CCCACAGGATTTCTTGGACCATTAAAGCTAGGTAATCCGAAAGTAGACCACCGTCCACACTGCTTGCTAA TGCTCCTTTCTCCATCTGGCGTCTTGTGTGGGTATTATCCAACACTGGGGGTCGTCTGGAACTCTTCTAT ATCTGTTTCTGAACGCTTGTAGTGTGTTGGACGTCCTTTTCTTGATGGACGAATGAGGGTCCACTTTATA TAATGTCAACATATCATGTGACCCACGAAGCCATTAAGTATATTGGCACTTTGCTAACTTTGTATTTGTG TTCTTGACTTCCACTTGAATCTTCTCCATTTATTACCATCGTTAATCTGTTTTCATTAGAAGCCAACAAT AGTAGAATATATGAAAAACACAAAAAAATAATCAAAAACTCTGTTGCCGTTGAGATACTAATACATTGTG AATGAATTTGAAATATATTTAGCACTTTAGGGGGTTTCCTGTCGGAGATTCCCTTTTAGCTTTGTAACCC ATACGTGTCTAACATGGCCGTCGAAGTTTTTTTTTTTTTGATAGTCATGATGCTTTCTAAAAGAATAATG TGTTTTTTTGTGTTTCATTATTCTCTTTTATGAATATAGTCTATTTTATGAGCCATGTTTTTCTTTTGTT ATGTGTGTTTATCCAGTTTCAGCATAAGTCGCGATGCTCTATGTTAGTCACTCCTCCTGTTTTTAGTTTT ATTTAATTTTATTTAAGAGGTCCAACTTGTAGGCAGGGATGAGAATTTGTGCAACGTTGCCGATGAGATC TGTGAACAGATTGTATTCTCCTCCAGCAGAGCGTCTTCGGTGCGTGTGTGCGAGCGCGTTCGGCAGAATT ACACAGAGCACATGGCTGTTTGTACTATATGAGATGCAGCTACAGTCTTGAATTGTATGTGGTTTGTGGA GGTTTATTCAAATAAGCACAAGCTCTGGAAGATGATTGGTTGTGGTGGAAATGCAAGGGATTGTTCACCC AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Gene targeted:
nuclear factor of activated T-cells 5, tonicity-re
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Vasculature: (4)
Morphology: (4)
Blood: (8)
Eye: (1)
- axis short length
(33.33%, dose:4.5ng, p53:ng, days: -)
- notochord undulate
(22.22%, dose:4.5ng, p53:ng, days: -)
- cardiovascular system [propose decreased flow]
(71.43%, dose:6ng, p53:ng, days: -)
- somite square
(71.43%, dose:6ng, p53:ng, days: -)

Images