MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: HS2068    
Morpholino sequence: GGATGCAATGGAATGAGGAAGCCAT
Find in Genbank
Target name: crtap
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CATAAGCCACCATGGCTTCCTCATTCCATTGCATCCGAATTGCATTATTAATAATCTCCTTTTCCGTTT GCGTCCTCGCGCAGTATGAGAAATATAACTTTCGCAGTTTCCCACGACACGAGCTGATGCCGCTGGACTC CGCGTACCGACATGCGTTAGACCTGTACAGTGAGGAGAAGTGGAAGGAGAGCGTGGAGTTTCTGGAGGTC AGTCTGCGGCTCTACCGGCTGCTCCGGGACAGCGAGGCCTTCTGTAGCCTCAACTGCAGCTCGGTCAGAC TCGACGATGAGACCCGTTTCAGCGACTTTCCCGAGCTGCAGGCCTTCGGTAATGTGATGAAGAGAGCTCA GTGTTTGAAGAGGTGCAAACAGGGGCTACCAGCCTTCAGACAGACCCTCCCCAGCCGGGACACCGTCGAT GAGTTTGATATACGGGAGCCGTACAAGTACCTGCAGTTCGCCTACTTCAAAAGTGATAATTTGGCCAAAG CGGTATCCGCTGCACACACATTCCTGCTGAAGCATCCTGATGATGAGATGATGCAGAGAAACATGAACTA CTACAAGAGTTTACCAGGAGCTGAGGACCATCTGAAAGACCTGGAGACCAAATCATACGAGATGCTGTTC ATTCGGGCCGTGCGAGCGTATAATGGAGATAATTTCCGAACGTCTGTGTCAGATATGGAGCTGGCACTGA GAGACTTTTTTAAGGTATACGATGAATGTATCGCCGCATCAGAAGGATCCAGACAGATTAAAGACTTTAA AGACTTTTACCCGTCCATCGCAGATCATTACTCGGAGGTTCTGGAGAGGAAGGTTCGCTGTGAGAGCGAG CTTACGCCGGTTGTTGGAGGATTTGTTGTTGAGAAATTTGTGGCGACTATGTATCACTACCTGCAGTTTG CCTATTATAAGTTGAATGACCTGAAGAACGCAGTGCCGTGTGTGTCCAGCTACATGCTCTTTGACCCCAG TGATGAGGTGATGAGGAATAACGTGGAATATTATCGCTTCCACAGAGAAAAATTTGGCCTCGACGATGAG GACTTCTTACCTAGAGCGGAAGCAGTGCGGTATCATAATCAGACGACGCTACAAATGCAGATGCTGGAAT TCGCCAAACAGAAGTTCATGCCAGATGATGAGGGTGAAGTTGTAGAGTTTCTTGATGAATATCTGGATGC TGAGGATGAATAACTGATTGTGTGAGTTTGAAATAAATGTGAAAAAGACCAGAAAGGTATTCCTCGTCCT GTAGTGTTGTTGCTGTTGTATTTATTTAGGGTTTGGTGATTGGAATTGTTGATATTTTTAGTTTTTACTC ATTATTTTAAAAAACGTCCTAGCACAGCACAGTCTTTACTCGTGCACCACAAGCCAAAAGATAATATATC TGAATCTCAGTCCCTGTCAACTTACTGTATCTCAGAGAAAACAATGTTCTGTGTTCTTTTTATTTCCTCA GATTGCTTTAATAAAGACTTGAATACAGTAAAAAAAAAAAAAAAAAAA
Gene targeted:
cartilage associated protein
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Vasculature: (10)
Morphology: (5)
Blood: (14)
Eye: (5)
- blood decreased
(50%, dose:2ng, p53:ng, days: 30 hours)
- intermediate cell mass of mesoderm [proposed pooling]
(50%, dose:2ng, p53:ng, days: 30 hours)
- eye absent
(30%, dose:3ng, p53:ng, days: Day: 3)
- eye small size
(60%, dose:3ng, p53:ng, days: Day: 3)
- eye small size
(90%, dose:4ng, p53:ng, days: Day: 3)
- eye absent
(80%, dose:4.5ng, p53:ng, days: Day: 3)
- eye dysplastic
(20%, dose:4.5ng, p53:ng, days: Day: 3)
- eye small size
(50%, dose:4.5ng, p53:ng, days: Day: 3)
- trunk colorless
(70%, dose:4.5ng, p53:ng, days: -)
- blood decreased
(50%, dose:6ng, p53:ng, days: 30 hours)
- eye absent
(70%, dose:6ng, p53:ng, days: -)
- eye absent
(80%, dose:6ng, p53:ng, days: Day: 3)
- eye dysplastic
(80%, dose:6ng, p53:ng, days: Day: 3)
- eye small size
(50%, dose:6ng, p53:ng, days: Day: 3)
- somite square
(50%, dose:6ng, p53:ng, days: -)
- whole organism hypoactive
(70%, dose:6ng, p53:ng, days: -)
- trunk colorless
(46.67%, dose:6ng, p53:ng, days: -)

Images