MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SC5001-control    
Morpholino sequence: TCATTACGAAAGTGAAAAGGTCGCT
Find in Genbank
Target name: hs6st2-reverse control
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CACGCGTCCGGAAGAATCACAAAGCAATCCGATGTAAGTTCGGACTACAAAGCCTCGTGGAAACATGTA GACACCGACTAGACTCGCTTCAATCAAACGAACATCCACCAGAAGCGCTGGGCGTGTTCGTGTTTTGATG TGCTCGAGTCACAGGTTTTGTTCAACATTCCTCCTGGCCGACGCGACGCGGTGAGCGAGCCGCCGCACAA CCGAGTAATGCTTTCACTTTTCCAGCGAGAAGATGGATGGGAAATCCAACTACAGCCGGCTACTCATCGC GCTGCTGATGATTCTGTTTTTTGGCGGAATTGTACTGCAATACATATGTTCAACATCCGACTGGCAGTTA CTACACCTGGCATCATTGTCCTCGAGGCTGGGGAGTCGCGCGCCCGGAGATCGCTTGAACGGAGCCGGTG CGGGAGATCCGTACAGCTCGGAGGACGGTGCTTTGGTTCGCTTTGTGCCTCGTTTTAATTTTACCACTAA AGACCTTAGTCGCGCGGTGGATTTCCACATTAAGGGGGACGATGTTATTGTGTTCCTCCACATTCAAAAA ACCGGTGGGACCACATTCGGCCGTCACCTGGTCCGCAACATCCAGCTGGAGAGGCCGTGCGAGTGCCATG CGGGCCAGAAGAAGTGTACCTGCTACCGGCCGGGCAAACGCGACACCTGGCTGTTCTCCCGCTTCTCCAC CGGCTGGAGCTGCGGTCTGCACGCGGACTGGACCGAGCTCACCAACTGCGTGCCTTCCTTCATGAGCAAC CGGGAGTCCCAGGAGAGACGCATGACTCCTAGTAGGAACTACTACTACATCACCATCTTGAGGGATCCGG TGTGGCGGTATCTCAGCGAATGGAGGCACGTTCAGCGTGGAGCCACTTGGAAAGCTTCTAAACACATGTG TGACGGCCGTTTACCCACCCTGACCGAGCTGCCCAGCTGTTATCCTGGCGACGACTGGTCCGGCTGCTCG CTGGAGGAATTCATGGTGTGCCCTTACAACCTAGCCAACAACAGACAGACCCGAATGCTGGCCGACCTCA GCCTGGTGGGCTGCTATAACCTCACGGTAATGAGCGAGAACCAGCGGTGGGCCATGCTACTGGAAAGTGC CAAGCGCAACTTGCGAAACATGGCCTTTTTTGGTCTGACCGAATATCAACGTAAGACGCAGTACCTGTTT GAACACACGTTCCGTCTTTCCTTCATCGCACCTTTTACACAGCTTAACGGCACCCGTGCTGCGAGCGTAG AAGTGGAACCGGAGACCCAACGCAGAATTCGAGAGCTTAACCAATGGGACGTGGAGCTATATGAATATGC ACGGGATCTTTTCCTCCAGCGCTTCCAGTTCGCCAGACAGCAGGAGCGCAGGGAGGCCCGTCAGCGACGC ATACAGGAGCGGCGAAAGCTACGTGCCAAGGTGAAGTCTTGGTTGGGGGTGACTGGAAAAGCGGTTTTTA AACCCACCAAGGAGCCACCAATGACAGAGCAGTCGCCCGCTTTTGCTGAAGAAAAACAAGCAGATGCTGA ACAAACGCTGGAGAGCGAGACCGAAGGACAGGTAGAGGAGAACTGGCTAGAGGAGGATGACGGTGAAATC ATGTTGGACTATTCAGAAAACGTAGAGCAGTGGCGGTAGCATTTGGGAAGAGGGTTGAACTTAATACTGA ACTAGAAAATGGTGATTCCATTTGATTACTTTATGGTACCTATAATCCTCGAAGCCCAAATCACTGCTGA ATATTAGCAATATACGGGTTGTTTATTGTGGGTTGCTTTTTATGTCACGTGCATTTGGTGAAATGCACAT GGAAATCTTCATATGTATCAGTTATTGGCTCCAGTTCTCTGTCAGATATCAATGAATGATCATCTGCAGC CTGACTCATCTTGTGAACTGAAGAGATGGTAAAATCCACTGTCCCATCAGCACTTTGCCCTTGAGAGAGG GCATTGTGAATTGCCGGTTGCACCAGGGAGGTCGTCTCTGCAGTTCTTGTACTGAAAATCACAATGCTTA TTGTGAAAGCCAAAGAGTGGAATGTTTCAGAAATGAGGGGGGAGCCAGGGTGGCTGCACATTTGTATTTA CATTCCTGTAATGCAAGTTTTTAGTTATTGCCTAATCATTTTTCAAGTGTCTTCAACTTTCACAATCCCA TGCATATCACGTCAGCCTTATGTCAAAGTCCAACACTTGTCTTTGTGTTTTTTTATATACATATATCTAT AAATATGCATTTCCTTCTCATTCTTTTATTTATATGTTTGCTAATAAATCACAGGATTTGGGTTGGCTCT GATTTTTCATTACTTGAAAGTAAAAAGCCATTAAGTTACTATGTCTTTATGCCACACCATATGTGTACTG AGGAGCACTGATTGCTCTGCTCTGGAAAGAATGATTACATTTGTGAATAATAATAAATACATTTTATAAT AATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Blood: (15)
PAX2: (1)
Eye: (5)
- blood [proposed pooling]
(45.45%, dose:2ng, p53:0ng, days: 30 hours)
- blood [proposed pooling]
(45.45%, dose:2ng, p53:0ng, days: 48 hours)
- blood absent
(18.18%, dose:2ng, p53:0ng, days: 30 hours)
- cardiovascular system [propose decreased flow]
(27.27%, dose:2ng, p53:0ng, days: 48 hours)
- eye absent
(40%, dose:2ng, p53:ng, days: Day: 3)
- common cardinal vein [proposed pooling]
(18.18%, dose:2ng, p53:0ng, days: 30 hours)
- tail [proposed pooling]
(27.27%, dose:2ng, p53:0ng, days: 48 hours)
- blood decreased
(50%, dose:3ng, p53:ng, days: 30 hours)
- intermediate cell mass of mesoderm [proposed pooling]
(50%, dose:3ng, p53:ng, days: 30 hours)
- eye absent
(90%, dose:3ng, p53:ng, days: Day: 3)
- eye dysplastic
(90%, dose:3ng, p53:ng, days: Day: 3)
- eye small size
(90%, dose:3ng, p53:ng, days: Day: 3)

Images