MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1992 A    
Morpholino sequence: TCAGCAGGAAGTACGTCACACACAT
Find in Genbank
Target name: hs6st2
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
EBRAFISH DNA SEQUENCE FROM CLONE DKEY-43B14 IN LINKAGE GROUP 2, COMPLETE SEQUENCE
Gene targeted:
heparan sulfate 6-O-sulfotransferase 2
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Cranial Motor Neuron: (2)
Vasculature: (2)
Eye: (4)
Toxicity: (2)
- cardiac ventricle large size
(48%, dose:7.5ng, p53:0ng, days: -)
- somite square
(24%, dose:7.5ng, p53:0ng, days: -)
- cranial nerve VII decreased number
(12%, dose:7.5ng, p53:0ng, days: -)
- cranial nerve VII mislocalised
(12%, dose:7.5ng, p53:0ng, days: -)
- cardiac ventricle large size
(5.88%, dose:15ng, p53:0ng, days: -)
- somite square
(58.82%, dose:15ng, p53:0ng, days: -)
- cranial nerve VII decreased number
(29.41%, dose:15ng, p53:0ng, days: -)
- cranial nerve VII mislocalised
(29.41%, dose:15ng, p53:0ng, days: -)
- cranial nerve V decreased number
(29.41%, dose:15ng, p53:0ng, days: -)
- cranial nerve V mislocalised
(29.41%, dose:15ng, p53:0ng, days: -)
- tail short length
(47.06%, dose:15ng, p53:0ng, days: -)

Images