MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1986 B    
Morpholino sequence: AATCAGTGCGTACAGTGTGAACTCG
Find in Genbank
Target name: TC76883-R
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
O SEQ. AT PRESENT
Gene targeted:
zgc:112367
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Morphology: (3)
Eye: (2)
Vasculature: (3)
- cardiovascular system decreased
(40%, dose:3ng, p53:ng, days: -)
- extension short length
(40%, dose:3ng, p53:ng, days: -)
- tail short length
(40%, dose:3ng, p53:ng, days: -)
- cardiovascular system decreased
(14.29%, dose:6ng, p53:ng, days: Day: 3)
- head dysplastic
(20%, dose:6ng, p53:0ng, days: -)

Images