MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1986 A    
Morpholino sequence: GGGTTAATTTCGAGCACGACAGGTG
Find in Genbank
Target name: TC76883-L
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
O SEQUENCE AT PRESENT
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Morphology: (3)
Toxicity: (1)
Vasculature: (4)
Eye: (4)
- cardiovascular system [propose decreased flow]
(28.57%, dose:3ng, p53:0ng, days: -)
- eye absent
(40%, dose:3ng, p53:ng, days: Day: 2)
- heart straight angle
(28.57%, dose:3ng, p53:0ng, days: -)
- somite square
(28.57%, dose:3ng, p53:0ng, days: -)
- head count
(11.11%, dose:6ng, p53:ng, days: Day: 3)
- immature otoliths count
(20%, dose:9ng, p53:0ng, days: -)

Images