MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1991 B    
Morpholino sequence: TAGTGATCTTGCTTAAGGTGACAG
Find in Genbank
Target name: TC74097L36
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
NLY GENOMIC SEQUENCE AVAILABLE AT PRESENT ZEBRAFISH DNA SEQUENCE FROM CLONE CH211-272P8 IN LINKAGE GROUP 23, COMPLETE SEQUENCE
Gene targeted:
signal sequence receptor, delta
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
ssr4
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Cranial Motor Neuron: (4)
Vasculature: (4)
Morphology: (8)
Toxicity: (6)
Eye: (14)
- eye dysplastic
(10%, dose:3ng, p53:ng, days: Day: 2)
- cranial nerve X decreased number
(75%, dose:3ng, p53:0ng, days: -)
- cranial nerve VII mislocalised
(75%, dose:3ng, p53:0ng, days: -)
- cranial nerve V mislocalised
(75%, dose:3ng, p53:0ng, days: -)
- pigment cells [propose more pigmetation]
(22.22%, dose:6ng, p53:0ng, days: -)
- eye absent
(30%, dose:6ng, p53:ng, days: Day: 2)
- eye absent
(20%, dose:6ng, p53:ng, days: Day: 3)
- tail coiled
(22.22%, dose:6ng, p53:0ng, days: -)
- axis short length
(28.57%, dose:7.5ng, p53:0ng, days: -)
- eye dysplastic
(30%, dose:7.5ng, p53:ng, days: Day: 2)
- head large size
(57.14%, dose:7.5ng, p53:0ng, days: -)
- axis short length
(57.14%, dose:9ng, p53:0ng, days: -)
- eye absent
(22.22%, dose:9ng, p53:ng, days: Day: 2)
- eye absent
(20%, dose:9ng, p53:ng, days: Day: 3)
- eye dysplastic
(22.22%, dose:9ng, p53:ng, days: Day: 2)
- eye dysplastic
(20%, dose:9ng, p53:ng, days: Day: 3)
- eye small size
(10%, dose:9ng, p53:ng, days: Day: 2)
- eye small size
(30%, dose:9ng, p53:ng, days: Day: 3)
- somite curved
(12.5%, dose:9ng, p53:ng, days: Day: 2)
- tail coiled
(22.5%, dose:9ng, p53:ng, days: Day: 2)

Images