MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1991 A    
Morpholino sequence: 5'-GGCTGTTGGTTGAATCTCTACTCAC-3'
Find in ZFIN Find in Genbank
Target name: ssr4
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
CGTGTCTGTCTGTGTTTCATTGGGTGAACAGACCCGAGTACTGCTCTCTTTTTAGGTTTGAGTGAGTAG AGATTCAACCAACAGCCCGGAGATCAACATGAAGCTAGTATTAACAACTCTTCTGGCTCTTTGTCTGAGC TTCTGTGCAGCTGAGACTTGCACAGACCCGGTGATTTCTCCGTCTTCATACACGACGACAGACGCGCTCA TCTCCTCCGAGACTGTGTTCATCGTTGAACTGAGTCTGGCGTGTGCAAACGGGGCTCAGAGCGTCGCCCT GTACGCTGATGTCAATGGCAAGCAGTTCCCTGTGACCAGAGGCCAAGATGTTGGCAAATACCAGGTGTCA TGGAGTGTTCCTCATAAGCAGGCCAGCTCAGGCACATATCAGGTCAAGTTCTTTGACGAGGAGTCTTACA GCACTCTACGAAAGGCTCAAAGAAACAATGAAGATGTCGACGCCATCAAGCCTTTGTTCTCTGTAAACGT GGATCACAGGGGTGCGTGGAATGGTCCATGGGTGTCAACGGAGGTCTTGGCTGCACTGATTGGCATTATG GTTTACTACCTGGCCTACAGCACCAAAAGTGCCATCCAGGCTTAAGAAGAGAAGAATTGCCATTTCCATT GTTCAAACTGGTCTTCATTACATCTTCATCTCCATTACATATTTGACATTTAATGTGCAGATTTTACTGC CACGGAAACCATAGTTAGAACCTGACACAGATCAAAATATGGACAAAGACAATTATTATAAAGTGGTGTT ATGTTTGCTTTGTTTTTTTTTTTAATCTGATATTGTCAAATAAAGGACAGAATTTTTCATTTGTGCTATT AATTTTAAACCTCAAAAGCTCTGAGGTGATTATCGGTGACTCCTCATCATCAAAGTCCAGTTCTGTGTTT TTGGAGTGTCCCAAATATCGATGAAATTCATTGAATGTGGGAATAAACAACTTTTCTGAAAGTTTT
Gene targeted:
signal sequence receptor, delta
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Cranial Motor Neuron: (8)
Vasculature: (2)
Toxicity: (2)
Morphology: (2)
Eye: (4)
- eye absent
(20%, dose:3ng, p53:ng, days: Day: 2)
- eye dysplastic
(10%, dose:3ng, p53:ng, days: Day: 2)
- somite square
(18.6%, dose:3ng, p53:0ng, days: -)
- cranial nerve VII mislocalised
(10%, dose:3ng, p53:0ng, days: -)
- cranial nerve V mislocalised
(11.11%, dose:3ng, p53:0ng, days: -)
- head count
(10%, dose:3ng, p53:ng, days: Day: 3)
- pigment cells absent
(57.14%, dose:6ng, p53:0ng, days: -)
- axis dysplastic
(33.33%, dose:6ng, p53:0ng, days: -)
- eye absent
(30%, dose:6ng, p53:ng, days: Day: 2)
- eye dysplastic
(20%, dose:6ng, p53:ng, days: Day: 2)
- immature otoliths count
(57.14%, dose:6ng, p53:0ng, days: -)
- head dysplastic
(57.14%, dose:6ng, p53:0ng, days: -)

Images


Figure 1. Tail defect in J compared to wild type in I.