MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1990 B    
Morpholino sequence: CTTCTTTTGGCTGACAGGTCTTACA
Find in Genbank
Target name: atp6v0c
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
TCTTCCTCTCCGCCGGCGACCAGCCTCCTGTCGGGTTCGTGACCGTCTCTCCTGCTTTTGTAAGACCTG TCAGCCAAAAGAAGACCTCACTCAGAGTCTAAACCTGCTAGACTGAAGCTTTCCTCCCTTTTCTGCCTTT AGTTTTAGTCTCCCGAACGCGCGAGAAGAATGGACACCCAGAACCCCCAGTACTCTCCCTTCCTCGCAGT GATGGGTGCCTCCTCAGCGATGGTGTTCAGCGCGTTGGGTGCTGCATACGGGACTGCTAAGAGCGGCACA GGCATTGCTGCCATGTCAGTGATGCGGCCAGAGCTGATCATGAAGTCCATCATTCCCGTGGTCATGGCGG GTATCATTGCCATCTACGGCCTGGTGGTGGCTGTACTCATTGCCAACAATATCGGTGATAAAATCTCGCT CTACAAGAGTATCCTGCATCTGGGAGCGGGTCTGAGTGTGGGTCTGAGCGGTCTCGCTGCCGGCTTCGCC ATCGGGATCGTGGGAGACGCAGGTGTGAGAGGAACGGCCCAGCAGCCGCGTCTGTTCGTGGGCATGATCC TCATCTTGATCTTTGCAGAGGTGCTGGGGCTCTACGGCCTGATCGTCGCCCTCATCCTGTCCACTAAGGG TTAATCGTTGCTCCTATCCTCTCTTACACATGAACAAACACACACACAGACACACACACCAACACAAATG ATATACAACGAGTAAACTTCACCGCCTGAATAACGACGAGAGGAATTTTTGCGTGCATGCGTGTATCGTG AGTGTGCTGTTTGCGATGAGTGAGCGTGAGATTGATCTTCCTCTCTGTGTAAAGAAGCCCGATGTGTGTG TGTTTTTCTTTCCCCCCTGTAAATGCGCTGTGTAGCTATCGCTCTCGTCCCGTGTGTGTGTG
Gene targeted:
ATPase, H+ transporting, lysosomal, V0 subunit c
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
atp6l
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Cranial Motor Neuron: (4)
Pigment: (1)
Vasculature: (1)
Morphology: (3)
Toxicity: (2)
Eye: (5)
- somite square
(18.18%, dose:3ng, p53:0ng, days: -)
- cranial nerve X decreased number
(4.55%, dose:3ng, p53:0ng, days: -)
- cranial nerve VII decreased number
(4.55%, dose:3ng, p53:0ng, days: -)
- cranial nerve V decreased number
(4.55%, dose:3ng, p53:0ng, days: -)
- pigment cells [propose more pigmetation]
(16.67%, dose:6ng, p53:0ng, days: -)
- eye absent
(25%, dose:6ng, p53:ng, days: Day: 3)
- eye small size
(16.67%, dose:6ng, p53:ng, days: Day: 3)
- somite square
(18.52%, dose:6ng, p53:0ng, days: -)
- cranial nerve X decreased number
(14.81%, dose:6ng, p53:0ng, days: -)
- cranial nerve VII decreased number
(14.81%, dose:6ng, p53:0ng, days: -)
- cranial nerve VII mislocalised
(3.7%, dose:6ng, p53:0ng, days: -)
- cranial nerve V decreased number
(14.81%, dose:6ng, p53:0ng, days: -)
- cardiovascular system decreased
(50%, dose:9ng, p53:0ng, days: -)
- dorsal aorta short length
(16.67%, dose:9ng, p53:0ng, days: -)
- lens hypertrophied
(16.67%, dose:9ng, p53:0ng, days: -)
- pigment cells absent
(57.14%, dose:9ng, p53:0ng, days: -)
- axis dysplastic
(50%, dose:9ng, p53:0ng, days: -)
- eye absent
(10%, dose:9ng, p53:ng, days: Day: 2)
- eye absent
(28.57%, dose:9ng, p53:ng, days: Day: 3)
- eye dysplastic
(10%, dose:9ng, p53:ng, days: Day: 2)
- whole organism hypoactive
(16.67%, dose:9ng, p53:0ng, days: -)

Images