MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1990 A    
Morpholino sequence: GTTCGGGAGACTAAAACTAAAGGCA
Find in ZFIN Find in Genbank
Target name: atp6v0c
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GTCTCTCCTGCTCCTGCAAGACCTGTCAGCCAAAAGAAGACCTCACTCAGAGTCTAAACCTGCTAGACTGAAGCTTTCCTCCCTTTTCTGCCTTTAGTTTTAGTCTCCCGAACGCGCGAGAAGAATGGACACCCAGAACCCCCAGTACTCTCCCTTCTTCGCAGTGATGGGTGCCTCCTCAGCGATGGTGTTCAGCGCGTTGGGTGCTGCATACGGGACTGCTAAGAGCGGCACAGGCATTGCTGCCATGTCAGTGATGCGGCCAGAGCTGATCATGAAGTCCATCATTCCCGTGGTCATGGCGGGTATCATTGCCATCTACGGCCTGGTGGTGGCTGTACTCATTGCCAACAATATCGGTGATAAAATCTCGCTCTACAAGAGTTTCCTGCATCTGGGAGCGGGTCTGAGTGTGGGTCTGAGCGGTCTCGCTGCCGGCTTCGCCATCGGGATCGTGGGAGACGCAGGTGTGAGAGGAACGGCCCAGCAGCCGCGTCTGTTCGTGGGCATGATCCTCATCTTGATCTTCGCAGAGGTGCTGGGGCTCTACGGCCTGATCGTCGCCCTCATCCTGTCCACTAAGGGTTAATCGTTGCTCCTATCCTCTCTTACACATGAACAAACACACACACAGACACACACACCAACACAAATGATATACAACGAGTAAACTTCACCGCCTGAATAACGACGAGAGGAATTTTTTGCGTGCATGCGTGTATCGTGAGTGTGCTGTTTGCGATGAGTGAGCGTGAGATTGATCTTCCTCTCTGTGTAAAGTAGCCCGATGTGTGTGTGTGTGTTTTTCTTTCCCCCCTGTAAATGCGCTGTGTAGCTATCGCTCTCGTCCCGTGTGTGTGTGTTTGTGTGCGCGTGTGTTTAAATATAGACGCCCTCTTTCTCATACGCTACACTTTTTGTTTGTCATCCTCTTTTATTTAGTTATAATTTTACTCTCCTTTAAAGAACAAATCAACTGTTTTTGTTTAGTTTGTTTCTCACTTTCGGGACCATTCATTCCAATTATTAAAACACTGATGTTGAGGACCTAAATGTAAAAAAACAAAAGATGGATTATTGCTGTTTGTTTGTTTTGTTTTCTGTTCCTGATGATTATTTATGAAGATTTTGAGATGTTCATTAAACAGTTTAAGTGGATCAAAGTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Gene targeted:
ATPase, H+ transporting, lysosomal, V0 subunit c
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
atp6l
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Cranial Motor Neuron: (2)
Morphology: (5)
Toxicity: (2)
Vasculature: (2)
Eye: (1)
- cardiovascular system decreased
(14.29%, dose:6ng, p53:ng, days: -)
- eye absent
(90%, dose:6ng, p53:ng, days: Day: 2)
- notochord coiled
(25%, dose:6ng, p53:ng, days: -)
- head dysplastic
(100%, dose:6ng, p53:0ng, days: -)
- somite square
(17.86%, dose:7.5ng, p53:0ng, days: -)
- cranial nerve VII decreased number
(17.86%, dose:7.5ng, p53:0ng, days: -)
- cranial nerve V decreased number
(17.86%, dose:7.5ng, p53:0ng, days: -)
- tail coiled
(17.86%, dose:7.5ng, p53:0ng, days: -)
- tail short length
(17.86%, dose:7.5ng, p53:0ng, days: -)
- cardiovascular system decreased
(14.29%, dose:9ng, p53:0ng, days: -)
- dorsal aorta short length
(14.29%, dose:9ng, p53:0ng, days: -)
- notochord coiled
(85.71%, dose:9ng, p53:0ng, days: -)
- cranial nerve VII mislocalised
(56.52%, dose:15ng, p53:0ng, days: -)
- cranial nerve V mislocalised
(56.52%, dose:15ng, p53:0ng, days: -)
- tail coiled
(56.52%, dose:15ng, p53:0ng, days: -)
- tail short length
(56.52%, dose:15ng, p53:0ng, days: -)

Images


Figure 1. Reduced pigmentation.