MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1989 B    
Morpholino sequence: GAAATGTAGATATGGGTGTCAAAAT
Find in Genbank
Target name: tm9sf2
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GATGCTGCTACGCAGGCAGCGGTTACGCTAACGCTTGTGCTTAGACATCACCAATGTCTGAATTTTGACACCCATATCTACATTTCACGCATGTAAATACATCTACAGATTACTTAATCAGTCGGTCGTGGCAAAATGGTCGAGTTCCACCGTGTCCGTGTTGTATTTGTGTCGCTTTTCTTGTGCGGGTTGTTGCAGGACGCGTTGAGTTTCTATCTTCCTGGTTTGGCCCCGGTCAGCTTCTGTAAGAAAGAAGCGGGCGACAAAAACAGCGAAGTCCCAGACTGCAAGTCAACCATTGAGCTCTTTGTGAACAGGCTGGATTCTGTGGAGTCAGTTTTACCCTATGAATATACTGCGTTTGATTTTTGTGCTGAGCAACATGAGAAGCGTCCATCTGAGAACTTGGGCCAGGTGTTGTTTGGTGAGAGAATTGAGCTGTCCCCATATAAGTTTTTGTTCCAGAATGATTTGCAATGCCAGTCTGTCTGCGTCAAGTCTTACAAAACACAAGATGCAGGTGATAAAGCCAAATTGGATTTCCTCAAGAAGGGAATGCTCCTCAATTACCAACACCACTGGATTGTTGATAATATGCCGGTGACCTGGTGTTACGATGTGGGGGACAATCAGAAGTTCTGTAATCCTGGCTTTCCCATTGGTTGTTATGTCACAGATACAGGACGGGCCAAAGATGCCTGTGTGGTCAATGCTGACTTCAATGACAAAGACACCTTCTACATCTTCAACCATGTGGACATAACAATTTTCTACCACAATGTGGAAAATGAGGTTGCTGGTGCCAGACTGGTTGCAGCTAAGTTAGAGCCCAAAAGCTTTAAGCAGTCCAACGTAGACAAACCAGACTGCACAGGACCTCCCATGAGCCTGAGCAACAAGTTCAATGGAGAAATCAGGATACCCTACACTTACTCTGTCAAGTTTCTGGAGGATAAGACAATTCGCTGGGCCTCCAGATGGGATTACATTCTTGAGTCTATGCCACACACAAACATTCAGTGGTTCAGTATCATGAACTCTCTGGTCATCGTACTCTTCCTCTCTGGAATGGTCGCTATGATCATGCTTCGAACACTTCATAAAGATATCGCTCGATACAACCAGATGGACTCTGTGGAGGATGCACAGGAGGAATTTGGCAGGAAGCTGGTTCATGGAGATGTCTTCAGGCCGCCTAGGAAAGGCATGCTGCTGTCTGTGTTCCTTGGTTCTGGGACTCAGATCTTCATCATGACCTTTGTCACTCTATTTTTTGCCTGTTTGGGTTTCCTGTCACCTGCCAATCGCGGGGCTCTGATGACGTGTGCAGTGGTGCTGTGGGTGCTCTTGGGTACTCCAGCTGGTTATGTGGCTGCTCGCTACTACAAATCTTTCGGTGGTGAGAAGTGGAAGACCAATGTTCTGTTGACAGCTTTTCTCTGTCCAGGAGTGGTGTTTGCAGATTTCTTTGTGATGAATCTCATTTTGTGGGGTGAGGGTTCATCCGCTGCCATGCCCTTTGGCACTCTGGTTGCCATCCTGGCTCTGTGGTTTTGCATATCAGTGCCCCTCACCTTTATCGGAGCGTACTTCGGTTTCAAGAAAAGCGCCATTGAACATCCTGTGCGGACCAACCAGATTCCAAGACAGATTCCAGAGCAGTCCTTCTATACTAAACCTCTTCCTGGCATTGTCATGGGAGGAATCCTGCCATTCGGATGCATCTTCATCCAGCTGTTTTTCATTCTCAACAGCATCTGGTCTCACCAGATGTACTACATGTTTGGCTTTCTCTTCCTGGTCTTTATCATCTTGGTCATCACCTGCTCTGAGGCCACCATTCTCCTCTGCTACTTCCACCTGTGTGCTGAGGACTATCACTGGCAGTGGCGTTCTTTCCTGACCAGCGGATTCACAGCTGTTTATTTCCTGGTCTATGCCATCCATTACTTCTTCTCTAAGCTGCAGATCAGCGGACTTGCCAGCACCATTCTTTACTTTGGTTACACCATGATCATGGCGCTCATCTTCTTCCTCTTCACAGGCACCATTGGATTCTTCGCTTGCTTTTGGTTTGTCACCAAGATCTACAGCGTGGTCAAAGTGGATTAAATGAAAGCAATCTCAGATGAGACTGAACTTCTCTTCTCCGCCCAATGTGAGATCCCAGAGGGAGGGACCTGAGCGCTGTTTATCTTCTGTTGCCACGGCAACCCTTCTTTACATCAGCAACTCTAAATCTACAAATTTAATTTACTTTGCTGTGTGTGCGTGCGGGCGTGTGTACATTAGTAGTGCATATTCAACCAATTGGAAGAACTCTACACATCTGCTTCTTTAGTTGGAACAGAATACAGCAGAAACACACATTGGCCCTTATAACTCACATGGGTATTTACGATTTGGAGTTGTCATTTGTAAATATTACTTACTTTATTCTTTTGCTAACGTTCAAATGGAAGGGTAATGCATAAATCGCAGAGAAAACTAGCTCCAGTCATTGAATCTTCAAGGTGTCGGAAGTATGATTTTGTAAATATCTTCTTTTGTTTCTTAAATTCATCAAGCAAGAAAGTAGAAGTTGAAAGCCGAAGGACTTCATTCTTTGGGTTGATTTAAGAGTGAGGCTGTGTGAATTTTCTTTTTTTCCATCTTGTTGATACTGTACAATTACTGCTTGCGTATACTTGTGTATAACCAGTGGGGGGAATGTCTATTTAACTTTTTTGTTTGGTCATTTTTTCTTTGTTTTCTGTTTATGCCTCAACACTTTGTGTGCCTCATTATCACAGAGGAAAATCAAGACTGGTAAAAACTGATTTGGGAAGATGTGAAGTGCCCCGTCCTTACACAGGGGTAACTGGAGTGAAATGATTTCTTTTGTTTGTATATATGCACAGCGTTAAACGTGTGTCCAGCATAAACTACATTAGCTTGGTTGGCTACTCGGTTTTGGTTTTTGTCTTCTCTGATTTTGAGGTAATGAGATTACAAGAAAAATGAAAAAAAAAAAACTATTAGAAATAAAACCTTGTCTTCAAAAATAAAAAAAAAAAAAAAAA
Gene targeted:
transmembrane 9 superfamily member 2
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Cranial Motor Neuron: (2)
Toxicity: (2)
Morphology: (4)
Vasculature: (4)
Eye: (9)
- eye absent
(90%, dose:2ng, p53:ng, days: Day: 2)
- cardiovascular system decreased
(14.29%, dose:3ng, p53:0ng, days: -)
- lens hypertrophied
(33.33%, dose:3ng, p53:0ng, days: -)
- pigment cells absent
(100%, dose:3ng, p53:0ng, days: -)
- eye absent
(40%, dose:3ng, p53:ng, days: Day: 2)
- eye absent
(14.29%, dose:3ng, p53:ng, days: Day: 3)
- eye dysplastic
(20%, dose:3ng, p53:ng, days: Day: 2)
- retina decreased
(14.29%, dose:3ng, p53:0ng, days: -)
- retina decreased
(33.33%, dose:3ng, p53:0ng, days: -)
- whole organism hypoactive
(14.29%, dose:3ng, p53:0ng, days: -)
- whole organism hypoactive
(33.33%, dose:3ng, p53:0ng, days: -)
- tail short length
(71.43%, dose:3ng, p53:0ng, days: -)
- eye absent
(90%, dose:6ng, p53:ng, days: Day: 2)
- eye absent
(43.75%, dose:6ng, p53:ng, days: Day: 3)
- eye dysplastic
(21.74%, dose:6ng, p53:ng, days: Day: 3)
- eye small size
(10%, dose:6ng, p53:ng, days: Day: 2)
- tail coiled
(100%, dose:7.5ng, p53:0ng, days: -)
- head small size
(100%, dose:15ng, p53:0ng, days: -)

Images


Figure 1. Lack of tail development with edema.


Figure 2. Reduced pigmentation.