MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: SP1988 B    
Morpholino sequence: ACTTCAACAACCTGCCAACCGGACG
Find in Genbank
Target name: TC80846L27 mismatches
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
GGGAGGACTCACTGAAGCAAACATGGCGGCAGTTGGCAGGTTGTTGAAGTATATGTGGGATAAGGAGCC TGTGATTGCAGTGTCCTGTGTGATCGGAGTGGCAGCCTGCATTGTGCCGTTCGTGAGCCCTTATACAAAA TACACAGCAATGATGAACAAGGCTGTTCCGTACAATTATCCAGTACCTGTTCGAGATAATGGAAACATGC CGGACGTCCCAGCACATCCGTCTGACCCACAGGGAAGCAACCTGGAATGGCTGAAAAACCTGTGAGAAGT CCTACACAATCCTGTACAGTCCACATCCACCTTTACTTCAGTCTCAATAATAAAACTCTTTATTTGATTA TCTTGTCATTTTTCATAATTATTATAGGTTTCAGACCGGAGACCTCCATGTGGGAGGGGTTTTACTGCAT GTAGGCTGGGCGACCCCCAAGTGGGAGGGACTTATGCCGCAAGTGGGCTGGATTGCTGTTGTTGTAGACA TTAATAAAACACAACAGGTTACTGTGAGGTTGGGTTTAGGGTTGGAGTAGGTGTAGACATTCATTAAACA CTATAGGTTGGACTCTATGTCATATAAATGACAATAATAAAATGAAAACTCCAGGTTTATACAGCCCACT TGGAGCTCAAGTCCTACTAACTTCTAGCTGGCCTGGCTCCAACCTCCGTTTATATCCTTCTCGTTTCACC TGCCAGATCAACAATAAACACCAGCCATATAGCTGATATAAAGCTGGAACAGAGACCGACACGCATAAAA CGTCAGAGATTAACTTTGTTTATTGTAAGATCATTTAGAAAAGGATATAGTTATGACATTAAAACATTCA AGAATCAAAAATATGACTGATCCACAGAGACTCTGAATCCAGTGCTCATTTACACTGTAAAACATATCTG TAAGTTAGCAGTTTGACATAAATTCTGTATCATGTTTTTTTTTTCCATGTCTATTTATGCTTTTAAATTG CATTATGGTTCCTTGATATCAATCTCAAGAACTTTTAGCCTTTAAAAGTAAAAATATATCAGTGTAAAGT GATATTGTCTGGGCTGCTGTTGTATATTACGCTACAAAAACCTTGTAATAAACTGCCAGTTCGTTTTTGT TATATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAA
Gene targeted:
not assigned
Synonyms:
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Cranial Motor Neuron: (4)
Vasculature: (3)
Morphology: (1)
Eye: (4)
- extension short length
(100%, dose:3ng, p53:ng, days: Day: 2)
- cranial nerve X decreased number
(3.57%, dose:3ng, p53:0ng, days: -)
- cranial nerve VII decreased number
(3.57%, dose:3ng, p53:0ng, days: -)
- cranial nerve V decreased number
(3.57%, dose:3ng, p53:0ng, days: -)
- cranial nerve V mislocalised
(3.57%, dose:3ng, p53:0ng, days: -)
- head [proposed pooling]
(12.5%, dose:3ng, p53:0ng, days: -)
- eye dysplastic
(37.5%, dose:6ng, p53:ng, days: Day: 3)
- head count
(11.11%, dose:6ng, p53:ng, days: Day: 2)
- cranial nerve X decreased number
(100%, dose:7.5ng, p53:0ng, days: -)
- cranial nerve VII decreased number
(100%, dose:7.5ng, p53:0ng, days: -)
- cranial nerve V decreased number
(100%, dose:7.5ng, p53:0ng, days: -)

Images


Figure 1. Tail defects.


Figure 2. Tail defects.