MODB | ZFIN | Morpholino Index | Advance Search | BLAST Search | About MODB
Search By For Use * as a wildcard character (e.g. "BMP*"). For Tips on search see Search FAQs.
Morpholino Summary
General Information
Morpholino name: Hypothetical b    
Morpholino sequence: 5'-ACTGTGCTCCAATGATGGTCTTTAA-3'
Find in Genbank
Target name: melk
Target sequence: (Morpholino Target and ATG)
Search in Genbank Search in Ensembl
AACAACGTAACCGATTGTATGTTTTCATTCTTAAATTGTACATTATTTGTTGTTTTGAGCTCTTTTTTT ATCGGCGTTTTAAAGACCATCATTGGAGCACAGTTGGTGTATGTGTATTCAGTATGCCAGTAGACAGCAC TTCTGAACTCCTCAAGCACTATGAGGTTTATGAAACCATTGGCTCAGGTGGGTTTGCCAAGGTCAAACTT GGCAGACACAAACTGACAGGAGAGAAAGTAGCCATCAAAATAATGGAGAAAAAAGATCTTGGGGATGATC TGCCCAGAGTAAAGATAGAGATTGAGGCAATGAAGAACCTCAGTCATCAACATGTATGTCGTCTCTACCA TGTCATTGAGACCACAAGCAAAATCTACATGGTGCTTGAGTACTGTCCTGGAGGAGAACTCTTTGATTAC ATCATTGCTAAAGATCGGTTATCAGAGGAAGAGACCCGAGTGTTTTTTCGCCAGATCATCTCTGCGTTGG CCTATGTTCATAGCCAAGGTTATGCCCATCGAGACCTCAAACCTGAAAACTTGCTGATCGATGAAGATCA TAACCTAAAACTCATTGATTTTGGCCTGTGTGCCAAGCCAAAGGGTGGTTTGGGTTTTGAATTGCTGACA TGTTGTGGCAGTCCTGCATACGCAGCTCCAGAGCTCATTCAGGGCAAGGCTTACATCGGCTCTGAGGCTG ATGTTTGGAGTATGGGTGTATTGCTTTATGCACTACTGTGTGGTTTTCTACCATTTGATGATGACAATTG TATGGTTCTCTATAGAAAAATCACAAGAGGCAAATACAGCAACCCACACTGGCTTTCGCCTTCTAGTATT CTGCTTCTAAACCAAATGATGCAGGTGGACCCAAAGAGGCGTTTGACAGTGAAACATTTGCTTGATCACC CATGGGTTATGAGGGGCTACAGCACACCAGTGGAGTGGCACAGTAAATATCCATTGGGTCATATAGATGA AGACTGCATCACAGAAATGGCGGTGACTTTCAAACAGTCCAAACAACGAACTATCCAGCTTGTGTCTGAG TGGAAGTATGATCAAATAACAGCAACCTACCTTTTACTGCTGGCTAAGAAGCGCCAAGGCCGTCCTGTGC GTCTAAGAGCTGAATGCCCTGTGATTGACATTGTGTGTTCTCCTTTACAAGATATGCAACTGAAGAAGAG TCTACGCTTCACTGAGGATGATGATGGTGTTCACCCAGTGGTGCTCGGCTCTATGGTCTTTCCCCCTGAT TGCTACGATGACGAGAATCCCTGGACCCCTCTCACACCCAAGAACACACATACCACAAACACTCCACGCA TGAAGCTGTACCCTGAAACAACAGAGAAGTGGAATGAAATGGCTTACTCCCCCGTCATAGAGCACAGCAG ACCCTGCCGACAGAAGCCAGAGAGACGTGAGAGAACCAAGGAAAATAAAGAGAACCTGGCAGTGCCAGGC ACAGATGGAGATGTTTTTGCTCTGCCAGCGCCGCGAACTCCAACATACAACCGAAAGGTCAAATCCAACA GAACTGTAATGACAACACCCAACCACAACAACAACAAGAGCAGCGAAGTAAACAAAGGAGCGGGCAGTGC CACTAAAGAAGGGTCCCGCAGGAGAGAGGTGGAACAGCAGCAGAACGGCCAACAAGGAGAACTCAATATG TTGGCTTTTAGCCCTGAGCGAAGGTCTCGATCACTGGACCTGGCAGGCTGTCAGGTGGACAGTGGGCAGA AGCGTAAGGGAGGGAAAGTGTTTGGCAGTCTGGAAAGAGGCCTGGATAAAGTCATTACAATGCTTACACC CAGTAAAAAGAGAGGACCTCGAGATGGCCCACGCAAAATTAGGGCTCAGTATAATGTAACTCTCACCAAT CAAACGAATGCTGACCAAGTGCTCAATCAGATTCTCAGCATATTACCAGAGAAGAATGTGGACTTTGTTC AGAAGGGCTATACTCTGAAATGCCACACGCAGTCAGACTTTGGGAAGGTCACCATGCAGTTCGAGCTGGA GGTTTGTCTCCTGCAGAAGCCTGAGGTTGTGGGGATCCGTCGACAGCGGCTCAAAGGAGATGCCTGGGTT TATAAACACCTGGTAGAGGACATTCTGTCCTCCTCCAGCCAATGGTCTGCTTGATTTCCTTTACAGACGT CCATCTCCGTAAGCTATCATTATGTGCAGGAAGGTAGTACAGTA
Gene targeted:
maternal embryonic leucine zipper kinase
Find in ZFIN Find in Pubmed
All the morpholinos targets to the gene
Synonyms:
zMelk-like
Comments:
Reference:

Survival Curve: Normality Curve:
Note: When more than one data point existed per dose an average was used. p53 morpholino co-injections were used to minimize non-specific toxicity effects (Robu et al. PLoS Genetics 2007)
Screens Performed (number of tests): Defects Observed:
Eye: (6)
Vasculature: (1)
Blood: (1)
Behavior: (1)
Morphology: (1)
- eye absent
(20%, dose:3ng, p53:ng, days: Day: 2)

Images


Figure 1. Embryo with tail curvature, edema and reduced pigment.


Figure 2. Tail and pigment defect with brain edema.